Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan
- 1. Government of Khyber Pakhtunkhwa
- 2. The University of Agriculture, Peshawar
Description
In the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its colony characteristics, molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-triphenyl-tetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.
Translated Descriptions
Translated Description (Arabic)
في مناطق زراعة الطماطم التجارية في خيبر بختونخوا (KP) ؛ مقاطعة في شمال غرب باكستان، تم إجراء العديد من المسوحات الشاملة خلال عام 2012. كانت الأهداف الرئيسية للدراسة الحالية هي تحديد عزل Ralstonia solanacearum (R. solanacearum) من خلال خصائصه المستعمرة، والأدوات الجزيئية ؛ والتحقيق في قدرة هذا الممرض على التسبب في مرض الذبول البكتيري (BW)، عند تلقيحه في نبات الطماطم باستخدام طرق التلقيح المختلفة. لهذا الغرض، تمت زيارة ما مجموعه 74 موقعًا تغطي جميع أنحاء KP لوجود نباتات الطماطم المصابة بمرض BW، والناجمة عن R. solanacearum. تم عزل العامل الممرض البكتيري من الأنسجة النباتية المريضة من خلال زراعته على الوسط الانتقائي 2،3،5 - ثلاثي الفينيل - تترازوليوم كلوريد (TTC). استنادًا إلى مورفولوجيا مستعمرة R. solanacearum على صفائح الآجار ؛ وفحوصات الإمراض، تم تخمين حوالي 29 عزلًا على أنها R. solanacearum. ولتأكيد هوية هذه العزلات، تم إجراء تفاعل سلسلة بوليميراز (PCR) بوساطة أنواع محددة. تم استخدام اثنين من البرايمر المحدد، أي التمهيدي الأمامي: 5 'GTCGCCGTCAACACTTCC3'، والبرايمر العكسي: 5 'GTCGCCGTAGCAATGCGGAATCG3'، لتضخيم نطاق 281bp. تم تأكيد خمسة وعشرين عزلًا من أصل 29 وراثيًا على أنها R. solanacearum بناءً على نطاقها المضخم 281bp.Translated Description (French)
Dans les districts de culture commerciale de tomates de Khyber Pakhtunkhwa (KP) ; une province du nord-ouest du Pakistan, de multiples enquêtes complètes ont été menées en 2012. Les principaux objectifs de la présente étude étaient d'identifier l'isolat de Ralstonia solanacearum (R. solanacearum) à travers ses caractéristiques de colonie, ses outils moléculaires ; et d'étudier la capacité de cet agent pathogène à causer la maladie du flétrissement bactérien (FB), lorsqu'il est inoculé dans la plante de tomate à l'aide de différentes méthodes d'inoculation. À cette fin, un total de 74 sites couvrant l'ensemble du PK ont été visités pour détecter la présence de plants de tomates atteints de la maladie du BW, causée par R. solanacearum. L'agent pathogène bactérien a été isolé à partir de tissus végétaux malades en le cultivant sur le milieu sélectif de chlorure de 2,3,5-triphényl-tétrazolium (TTC). Sur la base de la morphologie des colonies de R. solanacearum sur les plaques de gélose ; et des essais de pathogénicité, environ 29 isolats ont été supposés être R. solanacearum. Pour confirmer davantage l'identité de ces isolats, une amplification en chaîne par polymérase (PCR) par amorces spécifiques à l'espèce a été réalisée. Deux amorces spécifiques, à savoir l'amorce directe : 5'GTCGCCGTCAACTCACTTTCC3' et l'amorce inverse : 5'GTCGCCGTAGCAATGCGGAATCG3', ont été utilisées pour l'amplification de la bande de 281 pb. Vingt-cinq isolats sur les 29 ont été génétiquement confirmés comme étant R. solanacearum sur la base de leur bande amplifiée de 281 pb.Translated Description (Spanish)
En los distritos de cultivo comercial de tomate de Khyber Pakhtunkhwa (KP), una provincia en el noroeste de Pakistán, se realizaron múltiples encuestas exhaustivas durante 2012. Los principales objetivos del presente estudio fueron identificar el aislado de Ralstonia solanacearum (R. solanacearum) a través de sus características de colonia, herramientas moleculares; e investigar la capacidad de este patógeno para causar la enfermedad del marchitamiento bacteriano (BW), al ser inoculado en la planta de tomate utilizando diferentes métodos de inoculación. Para ello, se visitaron un total de 74 localidades que abarcan todo el PK por la presencia de plantas de tomate con enfermedad BW, causada por R. solanacearum. El patógeno bacteriano se aisló de tejidos vegetales enfermos cultivándolo en el medio selectivo de cloruro de 2,3,5-trifenil-tetrazolio (TTC). Según la morfología de la colonia de R. solanacearum en las placas de agar; y los ensayos de patogenicidad, se estimó que alrededor de 29 aislados eran R. solanacearum. Para confirmar aún más la identidad de estos aislados, se llevó a cabo una reacción en cadena de la polimerasa (PCR) mediada por cebadores específicos de la especie. Se utilizaron dos cebadores específicos, es decir, cebador directo: 5'GTCGCCGTCAACTCACTTTCC3', y cebador inverso: 5'GTCGCCGTAGCAATGCGGAATCG3', para la amplificación de la banda de 281 pb. Se confirmó genéticamente que veinticinco aislados de los 29 eran R. solanacearum en función de su banda amplificada de 281 pb.Files
article_30611_d55a38a5349b8d0fa9d9dea0e9faa5fa.pdf.pdf
Files
(21 Bytes)
| Name | Size | Download all |
|---|---|---|
|
md5:343fe3eff483e9b8cda83bacee59de9c
|
21 Bytes | Preview Download |
Additional details
Additional titles
- Translated title (Arabic)
- التحديد الجزيئي والأمراض لعزلات رالستونيا سولاناساروم التي تم جمعها من شمال غرب باكستان
- Translated title (French)
- Identification moléculaire et pathogénicité des isolats de Ralstonia solanacearum prélevés au nord-ouest du Pakistan
- Translated title (Spanish)
- Identificación molecular y patogenicidad de aislados de Ralstonia solanacearum recolectados en el noroeste de Pakistán
Identifiers
- Other
- https://openalex.org/W2941315415
- DOI
- 10.21608/nrmj.2019.30611
References
- https://openalex.org/W1546904870
- https://openalex.org/W1992174924
- https://openalex.org/W1993274668
- https://openalex.org/W2106804201
- https://openalex.org/W2146209587
- https://openalex.org/W2163469316
- https://openalex.org/W2168149889
- https://openalex.org/W2223528319
- https://openalex.org/W2237511600
- https://openalex.org/W2239337345
- https://openalex.org/W2559969780
- https://openalex.org/W2794200549
- https://openalex.org/W2979570980