Published February 1, 2005 | Version v1
Publication Open

A Novel Peptide Isolated from a Phage Display Peptide Library with Trastuzumab Can Mimic Antigen Epitope of HER-2

Creators

  • 1. Peking University
  • 2. Peking University Cancer Hospital

Description

Trastuzumab, a humanized antibody to HER-2, has been shown to be effective in the treatment of breast cancer in which HER-2 overexpression and metastasis occurs. In our search for an effective mimic epitope of HER-2 binding with trastuzumab and to develop HER-2 peptide vaccine, we screened a phage display 12-mer peptide library with trastuzumab as the target. A mimetic peptide (mimotope) H98 (LLGPYELWELSH) that could specifically recognize trastuzumab was isolated. The DNA encoding peptide H98 was cloned and expressed as the fusion protein GST-H98 in Escherichia coli BL21. The purified GST-H98 could specifically bind to trastuzumab and block the binding of trastuzumab to HER-2 protein. Moreover, H98 could significantly block the function of trastuzumab inhibiting the growth of cancer cells. Mice that were immunized with GST-H98 made specific antibody to H98 as well as to HER-2. In addition, T-cell proliferation occurred in mice immunized with GST-H98. Although no sequence homology was found between H98 and HER-2, through the use of structure analysis we were able to determine that peptide H98 contributed to a conformational epitope of HER-2. Furthermore, we determined that the last two amino acids at the C terminus, and the third together with the fourth amino acid at the N terminus of peptide H98 are critical to the binding of H98 to trastuzumab. As a result, we conclude that peptide H98 has potential for being developed as a HER-2 vaccine for biotherapy of cancer with HER-2 overexpression. Trastuzumab, a humanized antibody to HER-2, has been shown to be effective in the treatment of breast cancer in which HER-2 overexpression and metastasis occurs. In our search for an effective mimic epitope of HER-2 binding with trastuzumab and to develop HER-2 peptide vaccine, we screened a phage display 12-mer peptide library with trastuzumab as the target. A mimetic peptide (mimotope) H98 (LLGPYELWELSH) that could specifically recognize trastuzumab was isolated. The DNA encoding peptide H98 was cloned and expressed as the fusion protein GST-H98 in Escherichia coli BL21. The purified GST-H98 could specifically bind to trastuzumab and block the binding of trastuzumab to HER-2 protein. Moreover, H98 could significantly block the function of trastuzumab inhibiting the growth of cancer cells. Mice that were immunized with GST-H98 made specific antibody to H98 as well as to HER-2. In addition, T-cell proliferation occurred in mice immunized with GST-H98. Although no sequence homology was found between H98 and HER-2, through the use of structure analysis we were able to determine that peptide H98 contributed to a conformational epitope of HER-2. Furthermore, we determined that the last two amino acids at the C terminus, and the third together with the fourth amino acid at the N terminus of peptide H98 are critical to the binding of H98 to trastuzumab. As a result, we conclude that peptide H98 has potential for being developed as a HER-2 vaccine for biotherapy of cancer with HER-2 overexpression. HER-2 (also known as Neu or ErbB-2) is a member of the epidermal growth factor receptor (also known as HER) family of receptor tyrosine kinase (1Yarden Y. Sliwkowski M.X. Nat. Rev. Mol. Cell. Biol. 2001; 2: 127-137Crossref PubMed Scopus (5670) Google Scholar). HER receptors are essential mediators of cell proliferation and differentiation in the developing embryo and in adult tissues (2Olayioye M.A. Neve R.M. Lane H.A. Hynes N.E. EMBO J. 2000; 19: 3159-3167Crossref PubMed Google Scholar). Overexpression of the HER-2 oncogene is a frequent molecular event in multiple human cancers, including breast, ovarian, gastric, and colorectal carcinomas (3Wang S.C. Zhang L. Hortobagyi G.N. Hung M.C. Semin. Oncol. 2001; 28: 21-29Crossref PubMed Google Scholar). In patients with breast cancer, HER-2 overexpression is an independent predictor of survival. It is associated with poor prognosis, aggressive disease, resistance to chemotherapy and hormone therapy (4Slamon D.J. Godolphin W. Jones L.A. Holt J.A. Wong S.G. Keith D.E. Levin W.J. Stuart S.G. Udove J. Ullrich A. Press M.F. Science. 1989; 244: 707-712Crossref PubMed Scopus (6289) Google Scholar, 5Slamon D.J. Clark G.M. Wong S.G. Levin W.J. Ullrich A. McGuire W.L. Science. 1987; 235: 177-182Crossref PubMed Scopus (10014) Google Scholar, 6Nicholson R.I. McClelland R.A. Gee J.M. Manning D.L. Cannon P. Robertson J.F. Ellis I.O. Blamey R.W. Breast Cancer Res. Treat. 1994; 29: 117-125Crossref PubMed Scopus (172) Google Scholar). The critical role of HER-2 in epithelial oncogenesis as well as its selective overexpression on malignant tissues makes it an ideal target for immunotherapy (7Disis M.L. Cheever M.A. Adv. Cancer Res. 1997; 71: 343-371Crossref PubMed Google Scholar). Monoclonal antibodies directed to HER-2 induce phenotypic changes in tumor cells including down-modulation of the HER2 receptor, inhibition of tumor cells growth, reversion of cytokine resistance, restoration of E-cadherin expression levels, and reduction of vascular endothelial growth factor production (8Sliwkowski M.X. Lofgren J.A. Lewis G.D. Hotaling T.E. Fendly B.M. Fox J.A. Semin. Oncol. 1999; 26: 60-70PubMed Google Scholar). The humanized anti-HER-2/neu antibody trastuzumab (Herceptin; Genentech, Inc., South San Francisco, CA) has been proven to be effective in clinical trials in patients with HER-2-associated metastatic breast cancer (9Nahta R. Hortobagyi G.N. Esteva F.J. Oncologist. 2003; 8: 5-17Crossref PubMed Scopus (103) Google Scholar), and has antitumor activities as both a single agent and in combination with chemotherapy (10Nabholtz J.M. Reese D.M. Lindsay M.A. Riva A. Clin. Breast Cancer. 2002; 3: S75-S79Abstract Full Text PDF PubMed Scopus (35) Google Scholar). The molecular mechanisms underlying these growth inhibitory effects are not entirely clear. There is some evidence that antibodies to HER-2 may antagonize the constitutive growth signaling properties of the HER-2 system, enlist immune cells to attack the tumor target, and augment chemotherapy-induced cytotoxicity (8Sliwkowski M.X. Lofgren J.A. Lewis G.D. Hotaling T.E. Fendly B.M. Fox J.A. Semin. Oncol. 1999; 26: 60-70PubMed Google Scholar). The clinical application of trastuzumab has shown efficacy. However, several important drawbacks (generation of anti-idiotypic antibodies, inadequate tissue distribution, levels necessitating multiple infusions and hence the associated cost) limit the usefulness of passive immunotherapy protocols (11Dakappagari N.K. Pyles J. Parihar R. Carson W.E. Young D.C. Kaumaya P.T. J. Immunol. 2003; 170: 4242-4253Crossref PubMed Scopus (67) Google Scholar). On the other hand, vaccination strategy is an alternative option that can elicit endogenous tumor inhibitory antibodies, stimulate immunologic memory, and accordingly provide long-term benefits to patients at lower costs. The use of a peptide or part of a protein rather than a whole protein as vaccines may circumvent tolerance against self-protein HER-2 and induce cross-reactive immunity. Although many anti-HER-2 antibodies inhibit the proliferation of cancer cells, some actively stimulate cancer growth. It is well known that different biological effects are associated with the epitope specificity of the antibodies. Isolation of epitopes recognized by trastuzumab, an anti-tumor therapeutic monoclonal antibody directed against HER-2, can be useful in the development of peptide-based vaccines that are capable of stimulating an immune response directed to tumors. The screening of phage display libraries is a powerful technique that has been used in epitope or ligand mapping studies to define peptides that bind to a given antibody or receptor molecule (12Romanov V.I. Curr. Cancer Drug Targets. 2003; 3: 119-129Crossref PubMed Scopus (33) Google Scholar, 13Liu R. Enstrom A.M. Lam K.S. Exp. Hematol. 2003; 31: 11-30Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 14Yip Y.L. Ward R.L. Curr. Pharm. Biotechnol. 2002; 3: 29-43Crossref PubMed Scopus (15) Google Scholar, 15Aina O.H. Sroka T.C. Chen M.L. Lam K.S. Biopolymers. 2002; 66: 184-199Crossref PubMed Scopus (281) Google Scholar). In this study, we used a phage display 12-mer peptide library to identify peptides that bind to trastuzumab, and tested their immune and biological activity. The screening of a 12-mer peptide library displayed on M13 filamentous phages led to the isolation of peptide H98 (LLGPYELWELSH). Further investigation showed that peptide H98, mimicking the binding epitope on HER-2 for trastuzumab, specifically blocked the binding of trastuzumab to HER-2 and elicited an anti-HER-2 antibody response as well as a cellular immune response in mice. Although no sequence homology was found between the mimotope and HER-2, given the known crystal structure of the binding domain of HER-2 and trastuzumab, we found that peptide H98 contributed to a conformational epitope of HER-2. Moreover, the last two amino acids at the C terminus, and the third together with the fourth amino acid at the N terminus of H98, were critical for the binding of H98 to trastuzumab. In addition, MutN1, a mutant of H98, enhanced the binding of trastuzumab to pro-peptide. The approach of using phage display peptide libraries to reveal conformational epitopes may play an important role in research of the immune activity of the HER-2 mimotopes. And the isolated peptide could become a candidate as a vaccine for the treatment of HER-2-associated cancers. Phage Library, Bacteria, Antibodies, Expression Vector, and Cells— The Ph.D.-12 Phage Display Peptide Library Kit E8110S was purchased from New England Biolabs (Beverly, MA). The library contained 1.5 × 1013 pfu 1The abbreviations used are: pfu, plaque-forming units; LB, Luria broth; ELISA, enzyme-linked immunosorbent assay; HRP, horseradish peroxidase; MTT, thiazolyl blue (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide); DHFR, dihydrofolate reductase./ml with a complexity of 2.7 × 109 transformants. The displayed peptides were expressed at the N terminus of the pIII coat protein of the filamentous coliphage M13. The library was stored in Tris-buffered saline, pH 7.5, with 50% glycerol. Phage was propagated in Escherichia coli strain ER2738, which was provided with the kit. Antibody trastuzumab was provided by Breast Cancer Center at Beijing Cancer Hospital. Horseradish peroxidase (HRP)-conjugated anti-M13 antibody and the glutathione S-transferase (GST) gene fusion system were purchased from Amersham Biosciences. The dihydrofolate reductase (DHFR) gene fusion system was purchased from Qiagen (Valencia, CA). The human breast cancer cell line SKBR3 (American Type Culture Collection, Manassas, VA) was cultured in Dulbecco's modified Eagle's medium (Hyclone), supplemented with 10% fetal calf serum. NIH3T3-ErbB2 cell line (provided by Dr. S. L. Sun, Peking University School of Oncology) was cultured in RPMI 1640 medium (Hyclone) supplemented with 10% fetal calf serum. Bio-panning and Selection of Phage—Human normal IgG and trastuzumab were separately immobilized on protein A-agarose beads (Amersham Biosciences). Phages (1.5 × 1011 pfu) were preabsorbed on beads containing immobilized human normal IgG to remove any phages that were not specifically reactive with trastuzumab. The phages, diluted in Tris-buffered saline containing 0.1% Tween 20, were incubated at 4 °C for 1 h with immobilized trastuzumab. The beads were washed 5 times with 0.1% Tween 20/Tris-buffered saline. Then the phages that bound with trastuzumab and beads complex were amplified by direct infection with E. coli ER2738. The amplified phages were purified by precipitation with 20% polyethylene glycol 8000 (PEG8000), 2.5 m NaCl and used in the next cycle. Three rounds of selection were performed. After that, individual plaques were picked up randomly and subjected to analysis by phage enzyme-linked immunosorbent assay (ELISA) and DNA sequencing, following amplification in E. coli ER2738. Phage ELISA—In total, 300 phage clones were tested for reactivity with trastuzumab by ELISA. A single clone was grown for 4.5 h in 1 ml of Luria broth (LB) and shaken at 37 °C. Bacterial cells were spun down, and the supernatant containing phage was added to the wells of a microtiter plate that was coated with 5 μg/ml trastuzumab or control human normal IgG in 0.1 m NaHCO3, pH 9.5, and then blocked with 5% skim milk in Tris-buffered saline. The plate was incubated at room temperature for 1 h and washed 5 times with 0.05% Tween/Tris-buffered saline. Bound phages were detected by incubation with HRP-conjugated anti-M13 antibody (Amersham Biosciences) for 1 h, followed by washing and the addition of a peroxidase substrate (o-phenylenediamine, 0.4 mg/ml) in citrate-phosphate buffer, pH 5.0, containing 0.02% (v/v) H2O2. The reaction was stopped with 50 μl of 12.5% H2SO4. A492 was determined by using a microplate reader (Bio-Rad model 550). DNA Sequencing and Peptide Synthesis—Single-stranded phage DNA was prepared from 26 immunopositive clones by standard techniques as described in the phage display peptide library kit and sequenced by Shenyou Biology Inc. (Shanghai, China). Peptides representing the sequence of the positive clone H98 (LLGPYELWELSH) and an irrelevant control random peptide F56 (WHDPTPWWSWET) were synthesized by Bio-Scientific Inc. (Xian, China). Expression of Recombinant GST Peptide and DHFR Peptide Fusion Proteins in E. coli—To detect the activity of peptide H98 simply and conveniently, GST-H98 and DHFR-H98 fusion proteins were prepared, respectively. To make the GST-H98 fusion protein, the sense (5′-GATCCTTGTTGGGTCCGTATGAGTTGTGGGAGCTTTCTCATTGAAAGCTTG) and the antisense (5′-TCGACAAGCTTTCAATGAGAAAGCTCCCACAACTCATACGGACCCAACAAG) oligonucleotide fragments encoding the positive clone H98, with stop codon, HindIII site, and sticky ends of BamHI/SalI shown by the underlined nucleotides, were synthesized by Sangon Company (Shanghai, China) and inserted at the BamHI and SalI site of the pGEX-4T-1 vector (Amersham Biosciences). The ligated DNAs were used to transform E. coli BL21 cells. DNA of recombinants was identified by digestion with HindIII and EcoRV and then confirmed by DNA sequence analysis. All of these procedures were carried out as described by Sambrook et al. (16Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 5.3-6.59Google Scholar). Purification of DNA from agarose gels was performed with a QIAquick DNA purification kit (Qiagen, Valencia, CA). For the preparation of GST-H98 fusion proteins, transformed bacteria were cultured in LB medium with ampicillin selection to an optical density of 0.8 at 600 nm. Next, 0.5 mm isopropyl-1-thio-β-d-galactopyranoside was added and the cultures were further incubated for 5 h at 30 °C. Cells were collected by centrifugation and resuspended in 20 ml of phosphate-buffered saline (PBS) with 1 mm phenylmethanesulfonyl fluoride and 1 mg/ml lysozyme. Cell suspensions were sonicated for 1 min at a 20% pulse. After the lysate was cleared by centrifugation at 12,000 rpm for 10 min at 4 °C, the GST-H98 fusion protein was purified with glutathione beads according to the manufacturer's instructions (Amersham Biosciences). To obtain DHFR-H98 fusion protein, the sense and antisense oligonucleotide fragments as described above were inserted at the BglII (the same sticky end as BamHI) and SalI sites of the pQE-40 vector (Qiagen). The ligated DNAs were used to transform E. coli SG13009 cells. The DHFR-H98 fusion protein was purified according to the manufacturer's instructions (Qiagen). ELISA—The reactivity of trastuzumab with GST and GST-H98 fusion protein was tested by ELISA. 96-Well microtiter plates were coated with 5 μg/ml GST or GST-H98 fusion protein in 0.1 m NaHCO3, pH 9.5, then blocked with 5% skim milk in PBS. The plates were added to dilutions of trastuzumab and held for 2 h at room temperature. Bound trastuzumab was detected using HRP-conjugated anti-human IgG antibody (Zhong Shan Co., Beijing, China) with 0.4 mg/ml o-phenylenediamine as a peroxidase substrate, as described under "Phage ELISA." Western Blot—The reactivity of trastuzumab with GST fusion protein was also tested by Western blot analysis. Two μg of GST, GST-H98, GST-HER-2, and DHFR-H98 fusion proteins were subjected to 12% SDS-PAGE and transferred to nitrocellulose. The proteins were probed with the anti-GST antibody to detect the expression of the GST fusion protein. They were also probed with either trastuzumab or human IgG antibody. After being washed, the filters were incubated with HRP-conjugated secondary antibody and then developed with an electro-chemiluminescence (ECL) system (Amersham Biosciences). Competitive Inhibition Assay—To test the inhibition of trastuzumab binding to HER-2, we coated 96-well microtiter plates with 5 μg/ml NIH3T3-ErbB2 cell lysate (which was prepared by lysing the cells in lysis buffer containing 1% Triton X-100, 1 mm EDTA, 1 mm phenylmethanesulfonyl fluoride, and 1 μg/ml aprotinin) or GST-H98 fusion protein in 0.1 m NaHCO3, pH 9.5. Next, 0.5 μg/ml trastuzumab was mixed with dilutions of H98, F56, GST, GST-H98, and NIH3T3-ErbB2 cell lysate, and preincubated for 1 h at room temperature, and then transferred to the plates. Bound trastuzumab was detected by standard ELISA as described above. The peptides or proteins were tested at 0, 0.5, 5, 10, and 50 μg/ml. Each dilution was tested in duplicate. The inhibition was calculated by using the following formula: (ATrastuzumab - ATrastuzumab with protein)/ATrastuzumab × 100%. The experiment was repeated three times. Cell Proliferation Assay with MTT—The human breast cancer cell line SKBR3 overexpressing HER-2 were seeded in 96-well microtiter plates at a density of 1 × 104 cells/well. After incubation overnight at 37 °C, Dulbecco's modified Eagle's medium containing either 1 μg/ml trastuzumab or human normal IgG with or without dilutions of peptides was added to the wells in a final volume of 150 μl. All treatments were performed in triplicate. The plates were incubated at 37 °C for 3 days. Numbers of live cells were measured using a thiazolyl blue (MTT, Sigma) cell proliferation assay by reading A492. The proliferation inhibition rate was calculated by the formula as follow: (AHuman normal IgG - ATrastuzumab+H98/F56)/AHuman normal IgG × 100%. Immunization—Six- to 8-week-old BALB/c mice (purchased from the Animal Center of the Chinese Medical Academy) were immunized subcutaneously with 40 μg of GST-H98 or GST alone that was emulsified in complete Freund's adjuvant the first time. Mice were boosted four times with the antigen emulsified in incomplete Freund's adjuvant every 3 weeks. Sera were taken on day 0 (preimmune) and 7 days after the third and fifth immunization. Antibody level in the sera of immunized mice was determined by ELISA. To test the antipeptide response, 96-well microtiter plates were coated with 5 μg/ml DHFR-H98 fusion protein in 0.1 m NaHCO3, pH 9.5, and then blocked with 5% skim milk in PBS. A 1:1000 dilution of mice sera was added to the plates, which were then held for 2 h at room temperature. Bound antibody was detected by using HRP-conjugated anti-mouse IgG antibody with 0.4 mg/ml o-phenylenediamine as the peroxidase substrate. To test the anti-HER-2 response, 96-well microtiter plates were coated with 1 × 104 cells/well of NIH3T3-ErbB2 and then blocked with 5% skim milk in PBS. A 1:100 dilution of mice sera was added to the plates and anti-HER-2 response was assessed by standard techniques as described above. T Cell Proliferation Assay—Spleen cells from 2 randomly selected BALB/c mice, which were immunized 4 times with GST-H98 or GST-other peptide, were isolated according to the standard techniques on day 7 post-immunization (17Baral R.N. Saha A. Chatterjee S.K. Foon K.A. Krieg A.M. Weiner G.J. Bhattacharya-Chatterjee M. Cancer Immunol. Immunother. 2003; 52: 317-327Crossref PubMed Scopus (30) Google Scholar). 96-Well microtiter plates were coated with peptide H98 at different concentrations (0, 1, 10, and 100 μg/ml) and then washed twice with PBS. The splenocytes (2 × 105/well) were cultured in the coated 96-well plate and incubated at 37 °C for 3 days. The number of live cells were measured by using the thiazolyl blue (MTT, Sigma) cell proliferation assay by reading A492. The proliferation percentage was calculated by the formula as follows: (AH98- Auntreated)/Auntreated × 100%. Each assay was performed at least in triplicate. The experiment was repeated twice. Structural Determinants of the Binding Sequence and Optimization of the Amino Acid Sequence—To analyze the minimal requisites for binding activity, a variety of truncation and mutation peptides were made fused with GST (Table I). The corresponding GST-truncate, GST-mutant, and GST-cyclic H98 peptide fusion proteins were expressed and purified as described above. The reactivity of trastuzumab with these GST fusion peptides was tested by ELISA and Western blot.Table ITruncations and mutants of peptide H98 Peptide H98 truncated at the N (N10 to N6), C (C10 to C6), or both N and C (M8 and M6) terminus, respectively. The mutant amino acids as well as additional cysteines were shown in boldface and underlined (MutN3–4, MutC1–2, MutN1–2, MutN1, cyclic H98).PeptideAmino acid sequenceH98LLGPYELWELSHN10LLGPYELWELN8LLGPYELWN6LLGPYEC10GPYELWELSHC8YELWELSHC6LWELSHM8GPYELWELM6PYELWEMutN3–4LLVAYELWELSHMutC1–2LLGPYELWELGAMutN1–2GAGPYELWELSHMutN1QLGPYELWELSHCyclic H98CLLGPYELWELSHC Open table in a new tab Phage Selection—To select the positive clones that bind to trastuzumab, a random 12-mer phage display peptide library composed of 1.5 × 1011 independent phage clones was preabsorbed by human serum IgG and then specifically absorbed with trastuzumab. For each biopanning, phages were titrated for pfu in the inputs and outputs to determine the degree of selection. The total number of phages bound to trastuzumab was increased from 8.2 × 104 pfu in the first round to 3.7 × 106 pfu in the third round. Specificity of Peptides Binding to Trastuzumab and Their Sequences—After 3 rounds of selection, roughly 13.7% (41/300) of the phage clones analyzed exhibited trastuzumab binding activity (data not shown). We sequenced 26 positive phage clones and 25 clones encoded the identical amino acid sequence (LLGPYELWELSH) named H98. Only one different sequence, H23 (HPRPYHHTLPLT), was seen. These two sequences are considerably different and have no obvious similarities in motif. The binding of trastuzumab to the fusion protein GST-H98 was also demonstrated by ELISA and Western blotting. For this experiment, oligonucleotide encoding the peptide H98 was expressed as a C-terminal extension of the GST protein. The results of the ELISA showed that trastuzumab could specifically bind to GST-H98 but not to GST (Fig. 1). As shown in Fig. 1, trastuzumab reacted with the GST fusion protein containing the H98, whereas no reaction was obtained with GST. The results of Western blotting also suggested that trastuzumab could specifically bind to H98 (Fig. 2).Fig. 2Western blot analysis of binding of trastuzumab to peptide. Different GST fusion proteins were prepared as described under "Experimental Procedures." Equal amounts (2 μg) of proteins were subjected to SDS-PAGE and transferred to nitrocellulose membranes. The proteins were probed with anti-GST antibody (right panel) to detect the expression of GST fusion peptides and then probed with either trastuzumab (left panel) or human serum IgG (middle panel). Lane 1, GST; lane 2, GST-H98; lane 3, GST-HER-2; lane 4, DHFR-H98.View Large Image Figure ViewerDownload Hi-res image Download (PPT) GST-H98 and Peptide H98 Inhibition of Trastuzumab Binding to HER-2—The results from the ELISA and Western blot above showed that peptide H98 bound to the variable regions of trastuzumab. However, to demonstrate that H98 resembled the epitope of HER-2, we had to show that H98 blocked binding between trastuzumab and HER-2. To perform these experiments, we used an ELISA in which antibody and inhibitors (GST-H98 or peptide H98) were preincubated and plated onto the microtiter plates coated with HER-2. This analysis revealed that GST-H98 and peptide H98 inhibited the binding of trastuzumab to HER-2 in a dose-dependent manner, but GST protein and irrelevant peptide F56 did not produce noteworthy inhibition on their interaction (Fig. 3A). HER-2 Inhibiting Trastuzumab Binding to GST-H98 —To demonstrate that the trastuzumab that bound to GST-H98 or peptide H98 was specific for HER-2, we used HER-2 to inhibit trastuzumab binding to GST-H98. Trastuzumab was premixed with different dilutions of HER-2. The results show that HER-2 significantly inhibited trastuzumab binding to GST-H98 (Fig. 3B). In Fig. 3B, GST alone also demonstrated a concentration-dependent inhibition on trastuzumab binding to GST-H98, but the GST-H98 fusion protein doubled or tripled the inhibition effect, as compared with GST. The results demonstrated that peptide H98 played a critical role in inhibiting trastuzumab binding to GST-H98. Peptide H98 Blocked the Function of Trastuzumab on Inhibiting Cell Growth—Trastuzumab is well known to inhibit the growth of breast cancer cells through interaction with HER-2. Because peptide H98 has the ability to block interaction between trastuzumab and HER-2, we therefore decided to test whether peptide H98 affects the ability of trastuzumab to inhibit cell growth. As shown in Fig. 4, the response of breast cancer cell SKBR3 to trastuzumab was significantly blocked by peptide H98 in a dose-dependent manner and the 50% block rate was reached when peptide H98 was present at a concentration of 60 μg/ml, whereas an equivalent concentration of the control peptide had no significant effect on cell growth inhibition. Mice Immunized with GST-H98 Made Anti-HER-2 Antibodies—Peptide H98 was expressed as a GST fusion protein (GST-H98), and the immunogenicities were evaluated in mice. Four of 5 mice immunized with GST-H98 generated peptide-specific antibody (Fig. 5A) as well as antibody to HER-2 (Fig. 5B) after the fifth immunization. The anti-HER-2 response was lower than the anti-peptide response, and the anti-peptide H98 response could be detected earlier than the anti-HER-2 response. No antipeptide or anti-HER-2 response was observed in mice immunized with GST. One of 5 mice generated antibody to HER-2 that could be detected in an immunoprecipitation Western blot assay (data not shown). Development of Cellular Immune Response—Cellular immunity induced in mice that were immunized with GST-H98 or GST-other peptide was evaluated with T-cell proliferation assay. The spleens of two mice were isolated for use in this assay. T-cell proliferation was assayed as described under "Experimental Procedures" using H98 as a stimulant. The results shown in Fig. 6 indicate that T-cell proliferation took place in mice immunized with GST-H98 but not in mice immunized with GST-other peptide. Structural Determinants of H98 Binding to Trastuzumab— Decrease in peptide length may simplify the modifications of the peptide sequence, as well as provide an indication of the characteristics of the binding cleft. The ELISA and Western blot results showed that among 15 kinds of GST-H98 including GST-truncate and GST-mutant peptide fusion protein, only GST-H98, GST-C10, GST-MutN1–2, GST-MutN1, and GST-cyclic H98 were able to specifically bind to trastuzumab (Figs. 7 and 8).Fig. 8Western blot analysis of trastuzumab binding to different GST peptide fusion proteins. The GST fusion proteins were prepared as described under "Experimental Procedures." Equal amounts (2 μg) of proteins were subjected to SDS-PAGE and transferred to nitrocellulose membranes. Anti-GST antibody (upper panel)or trastuzumab (lower panel) was used separately as the first antibodies, and an HRP-conjugated secondary antibody was applied to detect the protein reactions as described under "Experimental Procedures." Lane 1, GST; lane 2, GST-H98; lane 3, GST-N10; lane 4, GST-N8; lane 5, GST-N6; lane 6, GST-C10; lane 7, GST-C8; lane 8, GST-C6; lane 9, GST-M8; lane 10, GST-M6; lane 11, GST-MutN3–4; lane 12, GST-MutC1–2; lane 13, GST-MutN1–2; lane 14, GST-MutN1; lane 15, GST-cyclic H98.View Large Image Figure ViewerDownload Hi-res image Download (PPT) As shown in Figs. 7 and 8, GST-MutN3–4 (mutant of N-terminal GP to VA) and GST-C8 could not bind to trastuzumab, but GST-C10 could bind to trastuzumab. These differences in binding abilities imply that the third and fourth amino acids, glycine (Gly) and Proline (Pro), at the N terminus were essential for the activity of peptide H98. Moreover, neither GST-MutC1–2 (mutant of C-terminal SH to GA) nor GST-N10 could bind to trastuzumab, which suggested that serine (Ser) and histidine (His) at the C terminus were also essential to retain complete peptide binding activity. Alternatively, the ability of GST-MutN1–2 to bind to trastuzumab was significantly impaired but not completely abolished, which implied that the first two leucines (LL) at the N terminus were not very important for the binding activity of H98 but were likely to have an effect on the marginal structure formation of the peptide. Further deletion of 4 or 6 residues at the N or C terminus completely abolished the ability of peptide H98 to bind to trastuzumab. Thus it appears that the peptide must be more than 8 amino acids in length to fulfill the requirements of binding. Accordi

⚠️ This is an automatic machine translation with an accuracy of 90-95%

Translated Description (Arabic)

وقد ثبت أن تراستوزوماب، وهو جسم مضاد إنساني لـ HER -2، فعال في علاج سرطان الثدي الذي يحدث فيه التعبير المفرط عن HER -2 والانبثاث. في بحثنا عن حاتمة محاكاة فعالة لربط HER -2 مع تراستوزوماب ولتطوير لقاح الببتيد HER -2، قمنا بفحص مكتبة ببتيد عرض العاثية 12 - mer مع تراستوزوماب كهدف. تم عزل الببتيد المحاكي (mimotope) H98 (LLGPYELWELSH) الذي يمكن أن يتعرف على تراستوزوماب على وجه التحديد. تم استنساخ الببتيد المشفر للحمض النووي H98 وتم التعبير عنه على أنه بروتين الاندماج GST - H98 في الإشريكية القولونية BL21. يمكن أن يرتبط GST - H98 المنقى على وجه التحديد بتراستوزوماب ويمنع ربط تراستوزوماب ببروتين HER -2. علاوة على ذلك، يمكن أن يمنع H98 بشكل كبير وظيفة تراستوزوماب الذي يثبط نمو الخلايا السرطانية. صنعت الفئران التي تم تحصينها بـ GST - H98 جسمًا مضادًا محددًا لـ H98 وكذلك لـ HER -2. بالإضافة إلى ذلك، حدث تكاثر الخلايا التائية في الفئران المحصنة بـ GST - H98. على الرغم من عدم العثور على تماثل تسلسلي بين H98 و HER -2، من خلال استخدام تحليل البنية، تمكنا من تحديد أن الببتيد H98 ساهم في حاتمة توافقية لـ HER -2. علاوة على ذلك، قررنا أن آخر اثنين من الأحماض الأمينية عند الطرف C، والثالث مع الحمض الأميني الرابع عند الطرف N من الببتيد H98 أمر بالغ الأهمية لربط H98 بتراستوزوماب. ونتيجة لذلك، نستنتج أن الببتيد H98 لديه القدرة على تطويره كلقاح HER -2 للعلاج الحيوي للسرطان مع التعبير المفرط عن HER -2. وقد ثبت أن تراستوزوماب، وهو جسم مضاد إنساني لـ HER -2، فعال في علاج سرطان الثدي الذي يحدث فيه التعبير المفرط عن HER -2 والانبثاث. في بحثنا عن حاتمة محاكاة فعالة لربط HER -2 مع تراستوزوماب ولتطوير لقاح الببتيد HER -2، قمنا بفحص مكتبة ببتيد عرض العاثية 12 - mer مع تراستوزوماب كهدف. تم عزل الببتيد المحاكي (mimotope) H98 (LLGPYELWELSH) الذي يمكن أن يتعرف على تراستوزوماب على وجه التحديد. تم استنساخ الببتيد المشفر للحمض النووي H98 وتم التعبير عنه على أنه بروتين الاندماج GST - H98 في الإشريكية القولونية BL21. يمكن أن يرتبط GST - H98 المنقى على وجه التحديد بتراستوزوماب ويمنع ربط تراستوزوماب ببروتين HER -2. علاوة على ذلك، يمكن أن يمنع H98 بشكل كبير وظيفة تراستوزوماب الذي يثبط نمو الخلايا السرطانية. صنعت الفئران التي تم تحصينها بـ GST - H98 جسمًا مضادًا محددًا لـ H98 وكذلك لـ HER -2. بالإضافة إلى ذلك، حدث تكاثر الخلايا التائية في الفئران المحصنة بـ GST - H98. على الرغم من عدم العثور على تماثل تسلسلي بين H98 و HER -2، من خلال استخدام تحليل البنية، تمكنا من تحديد أن الببتيد H98 ساهم في حاتمة توافقية لـ HER -2. علاوة على ذلك، قررنا أن آخر اثنين من الأحماض الأمينية عند الطرف C، والثالث مع الحمض الأميني الرابع عند الطرف N من الببتيد H98 أمر بالغ الأهمية لربط H98 بتراستوزوماب. ونتيجة لذلك، نستنتج أن الببتيد H98 لديه القدرة على تطويره كلقاح HER -2 للعلاج الحيوي للسرطان مع التعبير المفرط عن HER -2. HER -2 (المعروف أيضًا باسم NEU أو ErbB -2) هو عضو في عائلة مستقبلات عامل نمو البشرة (المعروفة أيضًا باسم HER) من مستقبلات التيروزين كيناز (1 ياردن Y. Sliwkowski M.X. نات. القس مول. الخلية. بيول. 2001 ؛ 2: 127-137 Crossref PubMed Scopus (5670) الباحث العلمي من Google). مستقبلاتها هي وسطاء أساسيون لتكاثر الخلايا وتمايزها في الجنين النامي وفي أنسجة البالغين (2Olayioye M.A. Neve R.M. Lane H.A. Hynes N.E. EMBO J. 2000; 19: 3159-3167 Crossref PubMed Google Scholar). التعبير المفرط عن الجين الورمي HER -2 هو حدث جزيئي متكرر في سرطانات بشرية متعددة، بما في ذلك سرطان الثدي والمبيض والمعدة والقولون والمستقيم (3Wang S.C. Zhang L. Hortobagyi G.N. Hung M.C. Semin. Oncol. 2001 ؛ 28: 21-29 Crossref PubMed Google Scholar). في المرضى الذين يعانون من سرطان الثدي، يعد التعبير المفرط عن HER -2 مؤشراً مستقلاً للبقاء على قيد الحياة. ويرتبط ذلك بسوء التشخيص والمرض العدواني ومقاومة العلاج الكيميائي والعلاج الهرموني (4Slamon D.J. Godolphin W. Jones L.A. Holt J.A. Wong S.G. Keith D.E. Levin W.J. Stuart S.G. Udove J. Ullrich A. Press M.F. Science. 1989 ؛ 244: 707-712 Crossref PubMed Scopus (6289) باحث جوجل، 5Slamon D.J. Clark GM Wong S.G. Levin W.J. Ullrich A. McGuire W.L. Science. 1987 ؛ 235: 177-182 Crossref PubMed Scopus (10014) Google Scholar، 6Nicholson RI McClelland RA Gee JM Manning DL Cannon P. Robertson JF Ellis IO Blamey RW. علاج سرطان الثدي. 1994 ؛ 29: 117-125 Crossref PubMed Scopus (172) الباحث العلمي من Google). إن الدور الحاسم لـ HER -2 في تكوين الورم الظهاري بالإضافة إلى التعبير المفرط الانتقائي على الأنسجة الخبيثة يجعله هدفًا مثاليًا للعلاج المناعي (7Disis M.L. Cheever M.A. Adv. Cancer Res. 1997; 71: 343-371 Crossref PubMed Google Scholar). تحفز الأجسام المضادة أحادية النسيلة الموجهة إلى HER -2 تغيرات النمط الظاهري في الخلايا السرطانية بما في ذلك التعديل السفلي لمستقبل HER2، وتثبيط نمو الخلايا السرطانية، وعودة مقاومة السيتوكين، واستعادة مستويات تعبير E - cadherin، والحد من إنتاج عامل نمو بطانة الأوعية الدموية (8Sliwkowski M.X. Lofgren J.A. Lewis G.D. Hotaling T.E. Fendly BM Fox J.A. Semin. Oncol. 1999 ؛ 26: 60-70 PubMed Google Scholar). وقد ثبت أن الجسم المضاد البشري المضاد لـ HER -2/NEU تراستوزوماب (هيرسيبتين ؛ جينينتيك، المحدودة، جنوب سان فرانسيسكو، كاليفورنيا) فعال في التجارب السريرية في المرضى الذين يعانون من سرطان الثدي النقيلي المرتبط بـ HER -2 (9Nahta R. Hortobagyi GN Esteva F.J. Oncologist. 2003 ؛ 8: 5-17 Crossref PubMed Scopus (103) Google Scholar)، ولديه أنشطة مضادة للأورام كعامل واحد وبالاقتران مع العلاج الكيميائي (10Nabholtz J.M. Reese D.M. Lindsay M.A. Riva A. Clin. سرطان الثدي. 2002 ؛ 3: S75 - S79 ملخص النص الكامل PDF PubMed Scopus (35) Google Scholar). الآليات الجزيئية الكامنة وراء هذه التأثيرات المثبطة للنمو ليست واضحة تمامًا. هناك بعض الأدلة على أن الأجسام المضادة لـ HER -2 قد تستعدي خصائص إشارات النمو التأسيسية لنظام HER -2، وتجنيد الخلايا المناعية لمهاجمة هدف الورم، وزيادة السمية الخلوية المستحثة بالعلاج الكيميائي (8Sliwkowski M.X. Lofgren J.A. Lewis G.D. Hotaling T.E. Fendly BM Fox J.A. Semin. Oncol. 1999 ؛ 26: 60-70 PubMed Google Scholar). أظهر التطبيق السريري لعقار تراستوزوماب فعاليته. ومع ذلك، فإن العديد من العيوب المهمة (توليد الأجسام المضادة المضادة للقوالب النمطية، وعدم كفاية توزيع الأنسجة، والمستويات التي تتطلب ضخًا متعددًا، وبالتالي التكلفة المرتبطة) تحد من فائدة بروتوكولات العلاج المناعي السلبي (11Dakappagari N.K. Pyles J. Parihar R. Carson W.E. Young D.C. Kaumaya P.T. J Immunol. 2003 ؛ 170: 4242-4253 Crossref PubMed Scopus (67) الباحث العلمي من Google). من ناحية أخرى، تعد استراتيجية التطعيم خيارًا بديلاً يمكن أن يثير الأجسام المضادة المثبطة للورم الداخلي، ويحفز الذاكرة المناعية، وبالتالي يوفر فوائد طويلة الأجل للمرضى بتكاليف أقل. قد يؤدي استخدام الببتيد أو جزء من البروتين بدلاً من البروتين الكامل كلقاحات إلى التحايل على التسامح ضد البروتين الذاتي HER -2 ويحفز المناعة المتفاعلة. على الرغم من أن العديد من الأجسام المضادة لـ HER -2 تمنع تكاثر الخلايا السرطانية، إلا أن بعضها يحفز بنشاط نمو السرطان. من المعروف جيدًا أن التأثيرات البيولوجية المختلفة ترتبط بخصوصية الحاتمة للأجسام المضادة. يمكن أن يكون عزل الحواتم التي يتعرف عليها تراستوزوماب، وهو جسم مضاد أحادي النسيلة علاجي مضاد للورم موجه ضد HER -2، مفيدًا في تطوير لقاحات قائمة على الببتيد قادرة على تحفيز استجابة مناعية موجهة للأورام. يعد فحص مكتبات عرض العاثيات تقنية قوية تم استخدامها في دراسات رسم خرائط الحاتمة أو الربيطة لتحديد الببتيدات التي ترتبط بجسم مضاد معين أو جزيء مستقبل (12Romanov V.I. Curr. أهداف علاج السرطان. 2003 ؛ 3: 119-129 Crossref PubMed Scopus (33) الباحث العلمي من Google، 13Liu R. Enstrom am Lam K.S. Exp. هيماتول. 2003 ؛ 31: 11-30 ملخص النص الكامل PDF PubMed Scopus (67) الباحث العلمي من Google، 14Yip Y.L. Ward R.L. Curr. الصيدلة. التكنولوجيا الحيوية. 2002 ؛ 3: 29-43 Crossref PubMed Scopus (15) باحث جوجل، 15Aina OH Sroka T.C. Chen M.L. Lam K.S. Biopolymers. 2002 ؛ 66: 184-199 Crossref PubMed Scopus (281) الباحث العلمي من Google). في هذه الدراسة، استخدمنا مكتبة ببتيد تحتوي على 12 عاثية لتحديد الببتيدات التي ترتبط بتراستوزوماب، واختبرنا نشاطها المناعي والبيولوجي. أدى فحص مكتبة ببتيد 12 - mer المعروضة على العاثيات الفتيلية M13 إلى عزل الببتيد H98 (LLGPYELWELSH). أظهر مزيد من التحقيق أن الببتيد H98، الذي يحاكي الحاتمة الملزمة على HER -2 لتراستوزوماب، منع على وجه التحديد ربط تراستوزوماب بـ HER -2 وأثار استجابة مضادة للأجسام المضادة لـ HER -2 بالإضافة إلى استجابة مناعية خلوية في الفئران. على الرغم من عدم العثور على تماثل تسلسلي بين المحاكي و HER -2، نظرًا للبنية البلورية المعروفة للمجال الملزم لـ HER -2 و trastuzumab، وجدنا أن الببتيد H98 ساهم في حاتمة توافقية لـ HER -2. علاوة على ذلك، كان آخر اثنين من الأحماض الأمينية عند الطرف C، والثالث مع الحمض الأميني الرابع عند الطرف N من H98، حاسمين لربط H98 بتراستوزوماب. بالإضافة إلى ذلك، عززت MutN1، وهي طفرة من H98، ربط تراستوزوماب إلى الببتيد. قد يلعب نهج استخدام مكتبات ببتيد عرض العاثيات للكشف عن الحواتم التوافقية دورًا مهمًا في البحث عن النشاط المناعي لـ HER -2 mimotopes. ويمكن أن يصبح الببتيد المعزول مرشحًا كقاح لعلاج السرطانات المرتبطة بـ HER -2. مكتبة العاثيات والبكتيريا والأجسام المضادة وناقلات التعبير والخلايا - تم شراء مجموعة مكتبة ببتيد عرض العاثيات E8110S من نيو إنجلاند بيولابس (بيفرلي، ماساتشوستس). تحتوي المكتبة على 1.5 × 1013 pfu 1 الاختصارات المستخدمة هي: pfu، وحدات تشكيل البلاك ؛ LB، مرق لوريا ؛ ELISA، مقايسة مناعية مرتبطة بالإنزيم ؛ HRP، بيروكسيداز الفجل ؛ MTT، ثيازوليل الأزرق (3 -(4،5 -ثنائي ميثيل ثيازول-2-يل) -2،5 -ثنائي فينيل تترازوليوم بروميد )؛ DHFR، اختزال ثنائي هيدروفولات./مل مع تعقيد 2.7 × 109 محولات. تم التعبير عن الببتيدات المعروضة في الطرف N من بروتين الطبقة pIII من القولونية الخيطية M13. تم تخزين المكتبة في محلول ملحي ثلاثي الحموضة، الرقم الهيدروجيني 7.5، مع 50 ٪ من الجلسرين. تم نشر العاثية في سلالة الإشريكية القولونية ER2738، والتي تم تزويدها بالمجموعة. تم توفير تراستوزوماب الأجسام المضادة من قبل مركز سرطان الثدي في مستشفى بكين للسرطان. تم شراء البيروكسيداز الفجل (HRP) - الجسم المضاد المقترن بـ M 13 ونظام دمج الجينات جلوتاثيون S - ترانسفيراز (GST) من شركة أميرشام للعلوم البيولوجية. تم شراء نظام اندماج جينات اختزال ثنائي هيدروفولات (DHFR) من كياجن (فالنسيا، كاليفورنيا). تم استزراع السلالة الخلوية لسرطان الثدي البشري SKBR3 (المجموعة الأمريكية لاستزراع النوع، ماناساس، فرجينيا) في وسط النسر المعدل في دولبيكو (هيكلون)، بالإضافة إلى مصل العجل الجنيني بنسبة 10 ٪. تم استزراع خط الخلايا NIH3T3 - ErbB2 (المقدم من الدكتور س. ل. صن، كلية الأورام بجامعة بكين) في RPMI 1640 متوسط (Hyclone) مكمل بمصل العجل الجنيني بنسبة 10 ٪. تم تثبيت الألواح الحيوية واختيار الملتهمة - الغلوبولين المناعي G الطبيعي البشري والتراستوزوماب بشكل منفصل على حبات بروتين A - agarose (Amersham Biosciences). تم امتصاص العاثيات (1.5 × 1011 pfu) مسبقًا على الخرزات التي تحتوي على الغلوبولين المناعي G البشري الطبيعي المثبت لإزالة أي عاثيات لم تكن متفاعلة على وجه التحديد مع تراستوزوماب. تم تحضين العاثيات، المخففة في محلول ملحي مخزن في تريس يحتوي على 0.1 ٪ توين 20، عند 4 درجات مئوية لمدة 1 ساعة مع تراستوزوماب مثبت. تم غسل الخرزات 5 مرات بنسبة 0.1 ٪ توين 20/محلول ملحي معقم. ثم تم تضخيم العاثيات المرتبطة بمركب التراستوزوماب والخرز عن طريق العدوى المباشرة بالإشريكية القولونية ER2738. تمت تنقية العاثيات المكبرة عن طريق الترسيب بنسبة 20 ٪ من البولي إيثيلين جلايكول 8000 (PEG8000)، 2.5 م من كلوريد الصوديوم واستخدمت في الدورة التالية. تم إجراء ثلاث جولات من الاختيار. بعد ذلك، تم التقاط اللويحات الفردية بشكل عشوائي وإخضاعها للتحليل عن طريق مقايسة الماصة المناعية المرتبطة بالإنزيم (ELISA) وتسلسل الحمض النووي، بعد التضخيم في الإشريكية القولونية ER2738. عاثية ELISA - في المجموع، تم اختبار 300 استنساخ عاثية للتفاعل مع تراستوزوماب بواسطة ELISA. تمت زراعة نسخة واحدة لمدة 4.5 ساعة في 1 مل من مرق لوريا (رطل) وتم رجها عند 37 درجة مئوية. تم نسج الخلايا البكتيرية، وتمت إضافة المادة الطافية التي تحتوي على عاثية إلى آبار صفيحة ميكروتيتر مغلفة بـ 5 ميكروغرام/مل تراستوزوماب أو تتحكم في الغلوبولين المناعي البشري الطبيعي في 0.1 متر من NaHCO3، الرقم الهيدروجيني 9.5، ثم تم سدها بحليب منزوع الدسم بنسبة 5 ٪ في محلول ملحي مخزن في تريس. تم تحضين الطبق في درجة حرارة الغرفة لمدة ساعة واحدة وغسله 5 مرات باستخدام 0.05 ٪ من المحلول الملحي Tween/Tris - buffered. تم الكشف عن العاثيات المقيدة عن طريق الحضانة باستخدام الجسم المضاد M13 المقترن بـ HRP (Amersham Biosciences) لمدة ساعة واحدة، تليها الغسيل وإضافة ركيزة البيروكسيداز (o - phenylenediamine، 0.4 مجم/مل) في عازلة السيترات والفوسفات، الرقم الهيدروجيني 5.0، التي تحتوي على 0.02 ٪ (v/v) H2O2. تم إيقاف التفاعل مع 50 ميكرولتر من 12.5 ٪ H2SO4. تم تحديد A492 باستخدام قارئ اللوحة الدقيقة (نموذج Bio - Rad 550). تسلسل الحمض النووي وتوليف الببتيد - تم تحضير الحمض النووي للعاثية المنفردة من 26 استنساخًا مناعيًا بتقنيات قياسية كما هو موضح في مجموعة مكتبة عرض الببتيد للعاثية والتي تم تسلسلها بواسطة شركة Shenyou Biology Inc. (شنغهاي، الصين). تم تصنيع الببتيدات التي تمثل تسلسل المستنسخ الإيجابي H98 (LLGPYELWELSH) والببتيد العشوائي غير ذي الصلة F56 (WHDPTPWWSWET) بواسطة شركة العلوم الحيوية (شيان، الصين). التعبير عن بروتينات اندماج الببتيد المؤتلف GST و DHFR في الإشريكية القولونية - للكشف عن نشاط الببتيد H98 ببساطة وسهولة، تم تحضير بروتينات اندماج GST - H98 و DHFR - H98، على التوالي. لصنع بروتين الانصهار GST - H98، تم تصنيع شظايا أوليجو نوكليوتيد (5'- GATCCTTGGGGGTCCGTATGAGTGTGGGGAGCTTGAAAGCTTG) ومضاد التحسس (5'- TCGACAAGCAGCTCCCAACTCATACGGACCCAACAAG) التي تشفر المستنسخ الإيجابي H98، مع كودون الإيقاف، وموقع HindIII، والأطراف اللزجة لـ BamHI/SALI الموضحة بواسطة النيوكليوتيدات المسطرة، من قبل شركة Sangon (شنغهاي، الصين) وإدراجها في موقع BamHI و SALI لمتجه pGEX -4T -1 (Amersham Biosciences). تم استخدام الحمض النووي المرتبط لتحويل خلايا الإشريكية القولونية BL21. تم تحديد الحمض النووي للمؤتلف عن طريق الهضم مع HindIII و EcoRV ثم تم تأكيده عن طريق تحليل تسلسل الحمض النووي. تم تنفيذ كل هذه الإجراءات كما وصفها سامبروك وآخرون. (16Sambrook J. Fritsch E.F. Maniatis T. الاستنساخ الجزيئي: دليل المختبر. الطبعة الثانية. مطبعة مختبر كولد سبرينغ هاربور، كولد سبرينغ هاربور، نيويورك 1989: 5.3-6.59 الباحث العلمي من Google). تم إجراء تنقية الحمض النووي من جل الأغاروز باستخدام مجموعة تنقية الحمض النووي QIAquick (Qiagen، Valencia، CA). لتحضير بروتينات الاندماج GST - H98، تم استزراع البكتيريا المحولة في وسط LB مع اختيار الأمبيسلين إلى كثافة بصرية تبلغ 0.8 عند 600 نانومتر. بعد ذلك، تمت إضافة 0.5 مم من الأيزوبروبيل-1 - thio - β - d - galactopyranoside وتم تحضين المستنبتات لمدة 5 ساعات عند 30 درجة مئوية. تم جمع الخلايا عن طريق الطرد المركزي وإعادة تعليقها في 20 مل من محلول ملحي مخزن للفوسفات مع فلوريد فينيل ميثان سلفونيل 1 مم وليزوزيم 1 مجم/مل. تم صوتنة معلقات الخلايا لمدة دقيقة واحدة بنبض 20 ٪. بعد إزالة الحالة عن طريق الطرد المركزي عند 12000 دورة في الدقيقة لمدة 10 دقائق عند 4 درجات مئوية، تمت تنقية بروتين الاندماج GST - H98 بخرز الجلوتاثيون وفقًا لتعليمات الشركة المصنعة (Amersham Biosciences). للحصول على بروتين الانصهار DHFR - H98، تم إدخال شظايا أوليجو نوكليوتيد المستشعر والمضاد كما هو موضح أعلاه في BglII (نفس النهاية اللزجة مثل BamHI) ومواقع SalI لمتجه pQE -40 (Qiagen). تم استخدام الحمض النووي المرتبط لتحويل خلايا الإشريكية القولونية SG13009. تمت تنقية بروتين الانصهار DHFR - H98 وفقًا لتعليمات الشركة المصنعة (Qiagen). ELISA - تم اختبار تفاعل تراستوزوماب مع GST و GST - H98 بروتين الانصهار بواسطة ELISA. 96 - تم طلاء صفائح ميكروتر جيدًا بـ 5 ميكروغرام/مل من GST أو بروتين اندماج GST - H98 في 0.1 متر من NaHCO3، الرقم الهيدروجيني 9.5، ثم تم حظرها مع 5 ٪ من الحليب الخالي من الدسم في PBS. تمت إضافة الألواح إلى مخففات التراستوزوماب وتم تثبيتها لمدة ساعتين في درجة حرارة الغرفة. تم اكتشاف تراستوزوماب مقيد باستخدام الجسم المضاد للغلوبولين المناعي جي البشري المقترن بـ HRP (شركة تشونغ شان، بكين، الصين) مع 0.4 مجم/مل من o - phenylenediamine كركيزة بيروكسيداز، كما هو موضح تحت عنوان "Phage ELISA."اللطخة الغربية - تم اختبار تفاعل تراستوزوماب مع بروتين اندماج GST أيضًا من خلال تحليل اللطخة الغربية. تم إخضاع اثنين ميكروغرام من بروتينات الاندماج GST و GST - H98 و GST - HER -2 و DHFR - H98 إلى 12 ٪ SDS - PAGE ونقلها إلى النيتروسليلوز. تم فحص البروتينات باستخدام الجسم المضاد لـ GST للكشف عن تعبير بروتين اندماج GST. كما تم فحصهم إما باستخدام التراستوزوماب أو الأجسام المضادة البشرية للغلوبولين المناعي G. بعد غسلها، تم تحضين المرشحات بجسم مضاد ثانوي مقترن بـ HRP ثم تم تطويرها بنظام التلألؤ الكيميائي الكهربائي (ECL) (Amersham Biosciences). اختبار التثبيط التنافسي - لاختبار تثبيط تراستوزوماب المرتبط بـ HER -2، قمنا بتغليف صفائح ميكروتر 96 بئرًا بـ 5 ميكروغرام/مل من NIH3T3 - ErbB2 (الذي تم تحضيره عن طريق تحليل الخلايا في مخزن التحلل الذي يحتوي على 1 ٪ تريتون X -100، 1 مم EDTA، 1 مم فينيل ميثان سلفونيل فلوريد، و 1 ميكروغرام/مل بروتينين) أو بروتين اندماج GST - H98 في 0.1 م NaHCO3، الرقم الهيدروجيني 9.5. بعد ذلك، تم خلط 0.5 ميكروغرام/مل من تراستوزوماب مع مخففات من H98 و F56 و GST و GST - H98 و NIH3T3 - ErbB2، وتم تحضينه مسبقًا لمدة ساعة واحدة في درجة حرارة الغرفة، ثم نقله إلى الصفائح. تم اكتشاف تراستوزوماب المقيد بواسطة ELISA القياسي كما هو موضح أعلاه. تم اختبار الببتيدات أو البروتينات عند 0 و 0.5 و 5 و 10 و 50 ميكروغرام/مل. تم اختبار كل تخفيف في نسختين. تم حساب التثبيط باستخدام الصيغة التالية: (أتراستوزوماب - أتراستوزوماب مع البروتين)/أتراستوزوماب × 100 ٪. تم تكرار التجربة ثلاث مرات. فحص تكاثر الخلايا باستخدام MTT - تم زرع سلالة خلايا سرطان الثدي البشرية SKBR3 التي تعبر بشكل مفرط عن HER -2 في 96 لوحة ميكروتر بكثافة 1 × 104 خلية/بئر. بعد الحضانة بين عشية وضحاها عند 37 درجة مئوية، تمت إضافة وسط النسر المعدل في دولبيكو الذي يحتوي إما على 1 ميكروغرام/مل من التراستوزوماب أو الغلوبولين المناعي G الطبيعي البشري مع أو بدون تخفيف الببتيدات إلى الآبار في حجم نهائي قدره 150 ميكرولتر. تم تنفيذ جميع العلاجات في ثلاث نسخ. تم تحضين الألواح عند 37 درجة مئوية لمدة 3 أيام. تم قياس أعداد الخلايا الحية باستخدام اختبار تكاثر خلايا الثيازوليل الأزرق (MTT، SIGMA) من خلال قراءة A492. تم حساب معدل تثبيط الانتشار بالصيغة التالية: (AHuman عادي IgG - ATrastuzumab + H98/F56)/AHuman طبيعي IgG × 100 ٪. التحصين - تم تحصين فئران BALB/c التي يتراوح عمرها بين ستة إلى ثمانية أسابيع (تم شراؤها من مركز الحيوانات التابع للأكاديمية الطبية الصينية) تحت الجلد بـ 40 ميكروغرام من GST - H98 أو GST وحدها والتي تم استحلابها في مادة فرويند المساعدة الكاملة في المرة الأولى. تم تعزيز الفئران أربع مرات مع استحلاب المستضد في مادة فرويند المساعدة غير المكتملة كل 3 أسابيع. تم أخذ الأمصال في اليوم 0 (قبل المناعة) وبعد 7 أيام من التطعيم الثالث والخامس. تم تحديد مستوى الأجسام المضادة في مصل الفئران المحصنة بواسطة ELISA. لاختبار استجابة مضادات الببتيد، تم طلاء صفائح ميكروتر 96 جيدًا ببروتين اندماج 5 ميكروغرام/مل DHFR - H98 في 0.1 متر من NaHCO3، ودرجة الحموضة 9.5، ثم تم حظرها مع 5 ٪ من الحليب الخالي من الدسم في PBS. تمت إضافة 1:1000 تخفيف من مصل الفئران إلى الصفائح، والتي تم الاحتفاظ بها بعد ذلك لمدة ساعتين في درجة حرارة الغرفة. تم الكشف عن الجسم المضاد المرتبط باستخدام الجسم المضاد لـ IgG المقترن بـ HRP مع 0.4 مجم/مل من o - phenylenediamine كركيزة بيروكسيداز. لاختبار الاستجابة المضادة لـ HER -2، تم طلاء صفائح ميكروتر 96 بئرًا بـ 1 × 104 خلية/بئر من NIH3T3 - ErbB2 ثم تم حظرها مع 5 ٪ من الحليب الخالي من الدسم في PBS. تمت إضافة 1:100 تخفيف مصل الفئران إلى الصفائح وتم تقييم الاستجابة المضادة لـ HER -2 من خلال التقنيات القياسية كما هو موضح أعلاه. تم عزل خلايا فحص تكاثر الخلايا التائية - الطحال من فئران BALB/c تم اختيارها عشوائيًا، والتي تم تحصينها 4 مرات باستخدام GST - H98 أو GST - الببتيد الآخر، وفقًا للتقنيات القياسية في اليوم السابع بعد التحصين (17Baral R.N. Saha A. Chatterjee S.K. Foon K.A. Krieg AM. Weiner G.J. Bhattacharya - Chatterjee M. Cancer Immunol. مناعة أخرى. 2003 ؛ 52: 317-327 Crossref PubMed Scopus (30) الباحث العلمي من Google). 96 - تم طلاء صفائح ميكروتر جيدًا بالببتيد H98 بتركيزات مختلفة (0 و 1 و 10 و 100 ميكروغرام/مل) ثم تم غسلها مرتين باستخدام PBS. تم استزراع الخلايا الطحالية (2 × 105/بئر) في الصفيحة المغلفة المكونة من 96 بئر وتم تحضينها عند 37 درجة مئوية لمدة 3 أيام. تم قياس عدد الخلايا الحية باستخدام اختبار تكاثر خلايا الثيازوليل الأزرق (MTT، SIGMA) من خلال قراءة A492. تم احتساب نسبة الانتشار بالصيغة كالتالي: (AH98 - Auntreated)/Auntreated × 100%. تم إجراء كل اختبار في ثلاث نسخ على الأقل. تكررت التجربة مرتين. المحددات الهيكلية لتسلسل الربط وتحسين تسلسل الأحماض الأمينية - لتحليل الحد الأدنى من المتطلبات لنشاط الربط، تم دمج مجموعة متنوعة من الببتيدات المقتطعة والطفرة مع ضريبة السلع والخدمات (الجدول الأول). تم التعبير عن بروتينات اندماج الببتيد H98 المناظرة لـ GST - truncate و GST - mutant و GST - cyclic وتنقيتها كما هو موضح أعلاه. تم اختبار تفاعل تراستوزوماب مع هذه الببتيدات الانصهار GST بواسطة ELISA و WESTERN BLOT.Table ITruncations وطفرات الببتيد H98 الببتيد H98 المبتورة في N (N10 إلى N6)، C (C10 إلى C6)، أو كل من N و C (M8 و M6)، على التوالي. تم عرض الأحماض الأمينية الطافرة بالإضافة إلى السيستينات الإضافية بخط عريض وتم وضع خط تحتها (MutN3 -4، MutC1 -2، MutN1 -2، MutN1، cyclic H98). تسلسل الأحماض الأمينية الببتيدية H98LLGPYELWELSHN10LGPYELWELN8LGPYELWN6LGPYEC10GPYELWELSHC8YELWELSHC6LWELSHM8GPYELWELM6PYELWEMutN3 -4LVAYELWELSHMutC1 -2LGPYELWELGAMutN1 -2GAGPYELWELWELSHULN1QLGPYELSHCYELWELSHCELSHCN6LWELSHC6LWELSHC6LWELSHM8GPYELWELWELM6PYELWELWEMutN3 -4LVAYELWELSHMUTN3 - LVAYELWELSHMULHMUTN1 -2LGPYELWELWELGAMUTN1 -2GAGPYELWELGAMUTN1 -2GAGPYELWELGAMUTN1 -2GAGYELWELSHWELSHWELSHWELSHULWELSHUTN1 -12GHWELSHWELSHWELSHWELSHWELSHWELSHWELSHMUTN1 -6LWELSHLWELSHLWELSHLWELSHN1 -4LWELSHLWELSHLWELSHC6LWELSHC6LWELSHC6LWELSHC6LWELSHC6LWELSHC6LWELSHC6LWELSHC6LWELSHC6LWELSHC6LWELSHC6LWELSHC6LWELSHC6L بالنسبة لكل تخطيط حيوي، تمت معايرة العاثيات من أجل pfu في المدخلات والمخرجات لتحديد درجة الاختيار. تمت زيادة العدد الإجمالي للعاثيات المرتبطة بتراستوزوماب من 8.2 × 104 pfu في الجولة الأولى إلى 3.7 × 106 pfu في الجولة الثالثة. خصوصية الببتيدات المرتبطة بتراستوزوماب وتسلسلها - بعد 3 جولات من الاختيار، أظهر ما يقرب من 13.7 ٪ (41/300) من استنساخ العاثيات التي تم تحليلها نشاط ربط تراستوزوماب (البيانات غير معروضة). قمنا بتسلسل 26 استنساخًا إيجابيًا للعاثية و 25 استنساخًا مشفرًا لتسلسل الأحماض الأمينية المتطابق (LLGPYELWELSH) المسمى H98. شوهد تسلسل واحد مختلف فقط، H23 (HPRPYHHTLPLT). هذان التسلسلان مختلفان إلى حد كبير وليس لهما أوجه تشابه واضحة في الزخارف. كما تم توضيح ارتباط التراستوزوماب ببروتين الاندماج GST - H98 من خلال ELISA والنشاف الغربي. بالنسبة لهذه التجربة، تم التعبير عن الأوليجو نوكليوتيد الذي يشفر الببتيد H98 كامتداد طرفي C لبروتين GST. أظهرت نتائج اختبار ELISA أن تراستوزوماب يمكن أن يرتبط على وجه التحديد بـ GST - H98 ولكن ليس بـ GST (الشكل 1). كما هو موضح في الشكل 1، تفاعل تراستوزوماب مع بروتين اندماج GST الذي يحتوي على H98، في حين لم يتم الحصول على أي تفاعل مع GST. كما أشارت نتائج النشاف الغربي إلى أن تراستوزوماب يمكن أن يرتبط على وجه التحديد بـ H98 (الشكل 2). الشكل 2 تحليل البقعة الغربية لربط تراستوزوماب بالببتيد. تم تحضير بروتينات اندماج GST المختلفة كما هو موضح تحت عنوان "الإجراءات التجريبية."تم إخضاع كميات متساوية (2 ميكروغرام) من البروتينات إلى SDS - PAGE ونقلها إلى أغشية النيتروسليلوز. تم فحص البروتينات باستخدام الجسم المضاد لـ GST (اللوحة اليمنى) للكشف عن تعبير ببتيدات اندماج GST ثم تم فحصها إما باستخدام تراستوزوماب (اللوحة اليسرى) أو مصل الإنسان IgG (اللوحة الوسطى). المسار 1، ضريبة السلع والخدمات ؛ المسار 2، ضريبة السلع والخدمات- H98 ؛ المسار 3، ضريبة السلع والخدمات- HER -2 ؛ المسار 4، DHFR - H98. عرض عارض الصور الكبيرة تنزيل صورة عالية الدقة تنزيل (PPT) GST - H98 والببتيد H98 تثبيط تراستوزوماب الربط بـ HER -2 - أظهرت النتائج من ELISA واللطخة الغربية أعلاه أن الببتيد H98 مرتبط بالمناطق المتغيرة من تراستوزوماب. ومع ذلك، لإثبات أن H98 يشبه حاتمة HER -2، كان علينا أن نظهر أن H98 منع الربط بين تراستوزوماب و HER -2. لإجراء هذه التجارب، استخدمنا ELISA حيث تم تحضين الأجسام المضادة والمثبطات (GST - H98 أو الببتيد H98) مسبقًا وطلاءها على لوحات ميكروتيتر المطلية بـ HER -2. كشف هذا التحليل أن GST - H98 والببتيد H98 يثبطان ربط تراستوزوماب بـ HER -2 بطريقة تعتمد على الجرعة، لكن بروتين GST والببتيد F56 غير ذي الصلة لم ينتجا تثبيطًا ملحوظًا على تفاعلهما (الشكل 3 أ). HER -2 تثبيط تراستوزوماب ملزم بـ GST - H98 - لإثبات أن تراستوزوماب المرتبط بـ GST - H98 أو الببتيد H98 كان محددًا لـ HER -2، استخدمنا HER -2 لتثبيط تراستوزوماب ملزم بـ GST - H98. تم خلط تراستوزوماب مسبقًا مع مخففات مختلفة من HER -2. تظهر النتائج أن HER -2 مثبط بشكل كبير تراستوزوماب المرتبط بـ GST - H98 (الشكل 3 ب). في الشكل 3 ب، أظهر GST وحده أيضًا تثبيطًا معتمدًا على التركيز على تراستوزوماب مرتبط بـ GST - H98، لكن بروتين الاندماج GST - H98 ضاعف أو ضاعف تأثير التثبيط ثلاث مرات، مقارنة بـ GST. أظهرت النتائج أن الببتيد H98 لعب دورًا حاسمًا في تثبيط تراستوزوماب المرتبط بـ GST - H98. حجب الببتيد H98 وظيفة تراستوزوماب على تثبيط نمو الخلايا - من المعروف أن تراستوزوماب يمنع نمو خلايا سرطان الثدي من خلال التفاعل مع HER -2. نظرًا لأن الببتيد H98 لديه القدرة على منع التفاعل بين التراستوزوماب و HER -2، فقد قررنا اختبار ما إذا كان الببتيد H98 يؤثر على قدرة التراستوزوماب على تثبيط نمو الخلايا. كما هو موضح في الشكل 4، تم حظر استجابة خلايا سرطان الثدي SKBR3 لتراستوزوماب بشكل كبير بواسطة الببتيد H98 بطريقة تعتمد على الجرعة وتم الوصول إلى معدل الكتلة 50 ٪ عندما كان الببتيد H98 موجودًا بتركيز 60 ميكروغرام/مل، في حين أن التركيز المكافئ لببتيد التحكم لم يكن له تأثير كبير على تثبيط نمو الخلية. تم التعبير عن الفئران المحصنة بـ GST - H98 المصنوعة من الأجسام المضادة لـ HER -2 - الببتيد H98 كبروتين اندماج GST (GST - H98)، وتم تقييم المناعة في الفئران. تم تحصين أربعة من أصل 5 فئران بجسم مضاد خاص بالببتيد ناتج عن GST - H98 (الشكل 5 أ) وكذلك الجسم المضاد لـ HER -2 (الشكل 5 ب) بعد التطعيم الخامس. كانت الاستجابة المضادة لـ HER -2 أقل من الاستجابة المضادة للببتيد، ويمكن اكتشاف الاستجابة المضادة للببتيد H98 قبل الاستجابة المضادة لـ HER -2. لم يلاحظ أي استجابة لمضاد الببتيد أو مضاد HER -2 في الفئران المحصنة بضريبة السلع والخدمات. قام واحد من 5 فئران بتوليد جسم مضاد لـ HER -2 يمكن اكتشافه في اختبار اللطخة الغربية للترسيب المناعي (البيانات غير معروضة). تم تقييم تطور الاستجابة المناعية الخلوية - المناعة الخلوية المستحثة في الفئران التي تم تحصينها بـ GST - H98 أو الببتيد الآخر لـ GST من خلال اختبار تكاثر الخلايا التائية. تم عزل طحال فأرين لاستخدامهما في هذا الفحص. تم فحص تكاثر الخلايا التائية كما هو موضح تحت "الإجراءات التجريبية" باستخدام H98 كمنشط. تشير النتائج الموضحة في الشكل 6 إلى أن تكاثر الخلايا التائية حدث في الفئران المحصنة بـ GST - H98 ولكن ليس في الفئران المحصنة بببتيد GST - other. المحددات الهيكلية لـ H98 الارتباط بتراستوزوماب - قد يؤدي الانخفاض في طول الببتيد إلى تبسيط تعديلات تسلسل الببتيد، بالإضافة إلى توفير مؤشر على خصائص الشق المرتبط. أظهرت نتائج ELISA و WESTERN BLOT أنه من بين 15 نوعًا من GST - H98 بما في ذلك بروتين اندماج الببتيد GST - truncate و GST - mutant، فقط GST - H98 و GST - C10 و GST - MutN1 -2 و GST - MutN1 و GST - cyclic H98 كانت قادرة على الارتباط على وجه التحديد بتراستوزوماب (الشكلان 7 و 8). 8 تحليل اللطخة الغربية لتراستوزوماب المرتبط ببروتينات اندماج الببتيد GST المختلفة. تم تحضير بروتينات الاندماج GST كما هو موضح تحت عنوان "الإجراءات التجريبية."تم إخضاع كميات متساوية (2 ميكروغرام) من البروتينات إلى SDS - PAGE ونقلها إلى أغشية النيتروسليلوز. تم استخدام الجسم المضاد لـ GST (اللوحة العلوية)أو تراستوزوماب (اللوحة السفلية) بشكل منفصل كأجسام مضادة أولى، وتم استخدام جسم مضاد ثانوي مقترن بـ HRP للكشف عن تفاعلات البروتين كما هو موضح في "الإجراءات التجريبية." حارة 1، ضريبة السلع والخدمات ؛ حارة 2، ضريبة السلع والخدمات- H98 ؛ حارة 3، ضريبة السلع والخدمات- N10 ؛ حارة 4، ضريبة السلع والخدمات- N8 ؛ حارة 5، ضريبة السلع والخدمات- N6 ؛ حارة 6، ضريبة السلع والخدمات- C10 ؛ حارة 7، ضريبة السلع والخدمات- C8 ؛ حارة 8، ضريبة السلع والخدمات- C6 ؛ حارة 9، ضريبة السلع والخدمات- M8 ؛ حارة 10، ضريبة السلع والخدمات- M6 ؛ حارة 11، ضريبة السلع والخدمات- MutN3 -4 ؛ حارة 12، ضريبة السلع والخدمات- MutC1 -2 ؛ حارة 13، ضريبة السلع والخدمات- MutN1 -2 ؛ حارة 14، ضريبة السلع والخدمات- MutN1 ؛ حارة 15، ضريبة السلع والخدمات- C98. عرض عارض الصور الكبيرة تنزيل صورة عالية الدقة (PPT) كما هو موضح في الشكلين. 7 و 8، GST - MutN3 -4 (متحولة من N - terminal GP إلى VA) و GST - C8 لا يمكن ربطها بتراستوزم، ولكن GST - C10 يمكن ربطها بتراستوزم. تشير هذه الاختلافات في قدرات الربط إلى أن الأحماض الأمينية الثالثة والرابعة، الجلايسين (GLY) والبرولين (PRO)، في النهاية N، كانت ضرورية لنشاط الببتيد H98. علاوة على ذلك، لا يمكن ربط GST - MutC1 -2 (طفرة الطرف C SH إلى GA) ولا GST - N10 بتراستوزوماب، مما يشير إلى أن السيرين (SER) والهستيدين (HIS) في الطرف C ضروريان أيضًا للاحتفاظ بنشاط ربط الببتيد الكامل. بدلاً من ذلك، تم إضعاف قدرة GST - MutN1 -2 على الارتباط بتراستوزوماب بشكل كبير ولكن لم يتم إلغاؤه تمامًا، مما يعني أن أول ليوسينينين (LL) في الطرف N لم يكونا مهمين جدًا لنشاط الارتباط لـ H98 ولكن من المحتمل أن يكون لهما تأثير على تكوين البنية الهامشية للببتيد. أدى المزيد من حذف 4 أو 6 بقايا في الطرف N أو C إلى إلغاء قدرة الببتيد H98 تمامًا على الارتباط بتراستوزوماب. وبالتالي يبدو أن الببتيد يجب أن يكون أكثر من 8 أحماض أمينية في الطول لتلبية متطلبات الربط.

Translated Description (French)

Le trastuzumab, un anticorps humanisé contre HER-2, s'est avéré efficace dans le traitement du cancer du sein dans lequel une surexpression et une métastase de HER-2 se produisent. Dans notre recherche d'un épitope mimétique efficace de la liaison de HER-2 avec le trastuzumab et pour développer le vaccin peptidique HER-2, nous avons criblé une bibliothèque peptidique de phage display 12-mer avec le trastuzumab comme cible. Un peptide mimétique (mimotope) H98 (LLGPYELWELSH) capable de reconnaître spécifiquement le trastuzumab a été isolé. L'ADN codant pour le peptide H98 a été cloné et exprimé sous la forme de la protéine de fusion GST-H98 chez Escherichia coli BL21. Le GST-H98 purifié pourrait se lier spécifiquement au trastuzumab et bloquer la liaison du trastuzumab à la protéine HER-2. De plus, H98 pourrait bloquer de manière significative la fonction du trastuzumab inhibant la croissance des cellules cancéreuses. Les souris qui ont été immunisées avec GST-H98 ont produit un anticorps spécifique contre H98 ainsi que contre HER-2. De plus, une prolifération des lymphocytes T s'est produite chez des souris immunisées avec le GST-H98. Bien qu'aucune homologie de séquence n'ait été trouvée entre H98 et HER-2, grâce à l'utilisation de l'analyse de structure, nous avons pu déterminer que le peptide H98 contribuait à un épitope conformationnel de HER-2. De plus, nous avons déterminé que les deux derniers acides aminés à l'extrémité C terminale et le troisième avec le quatrième acide aminé à l'extrémité N terminale du peptide H98 sont essentiels à la liaison de H98 au trastuzumab. En conséquence, nous concluons que le peptide H98 a le potentiel d'être développé en tant que vaccin HER-2 pour la biothérapie du cancer avec surexpression de HER-2. Le trastuzumab, un anticorps humanisé contre HER-2, s'est avéré efficace dans le traitement du cancer du sein dans lequel une surexpression et une métastase de HER-2 se produisent. Dans notre recherche d'un épitope mimétique efficace de la liaison de HER-2 avec le trastuzumab et pour développer le vaccin peptidique HER-2, nous avons criblé une bibliothèque peptidique de phage display 12-mer avec le trastuzumab comme cible. Un peptide mimétique (mimotope) H98 (LLGPYELWELSH) capable de reconnaître spécifiquement le trastuzumab a été isolé. L'ADN codant pour le peptide H98 a été cloné et exprimé sous la forme de la protéine de fusion GST-H98 chez Escherichia coli BL21. Le GST-H98 purifié pourrait se lier spécifiquement au trastuzumab et bloquer la liaison du trastuzumab à la protéine HER-2. De plus, H98 pourrait bloquer de manière significative la fonction du trastuzumab inhibant la croissance des cellules cancéreuses. Les souris qui ont été immunisées avec GST-H98 ont produit un anticorps spécifique contre H98 ainsi que contre HER-2. De plus, une prolifération des lymphocytes T s'est produite chez des souris immunisées avec le GST-H98. Bien qu'aucune homologie de séquence n'ait été trouvée entre H98 et HER-2, grâce à l'utilisation de l'analyse de structure, nous avons pu déterminer que le peptide H98 contribuait à un épitope conformationnel de HER-2. De plus, nous avons déterminé que les deux derniers acides aminés à l'extrémité C terminale et le troisième avec le quatrième acide aminé à l'extrémité N terminale du peptide H98 sont essentiels à la liaison de H98 au trastuzumab. En conséquence, nous concluons que le peptide H98 a le potentiel d'être développé en tant que vaccin HER-2 pour la biothérapie du cancer avec surexpression de HER-2. HER-2 (également connu sous le nom de Neu ou ErbB-2) est un membre de la famille des récepteurs du facteur de croissance épidermique (également connu sous le nom de HER) de la tyrosine kinase réceptrice (1Yarden Y. Sliwkowski M.X. Nat. Rev. Mol. Cell. Biol. 2001 ; 2: 127-137Crossref PubMed Scopus (5670) Google Scholar). SES récepteurs sont des médiateurs essentiels de la prolifération et de la différenciation cellulaire dans l'embryon en développement et dans les tissus adultes (2Olayioye M.A. Neve R.M. Lane H.A. Hynes N.E. EMBO J. 2000 ; 19: 3159-3167Crossref PubMed Google Scholar). La surexpression de l'oncogène HER-2 est un événement moléculaire fréquent dans de multiples cancers humains, y compris les carcinomes du sein, des ovaires, gastriques et colorectaux (3Wang S.C. Zhang L. Hortobagyi G.N. Hung M.C. Semin. Oncol. 2001 ; 28: 21-29Crossref PubMed Google Scholar). Chez les patientes atteintes d'un cancer du sein, la surexpression de HER-2 est un prédicteur indépendant de la survie. Il est associé à un mauvais pronostic, à une maladie agressive, à une résistance à la chimiothérapie et à l'hormonothérapie (4Slamon D.J. Godolphin W. Jones L.A. Holt J.A. Wong S.G. Keith D.E. Levin W.J. Stuart S.G. Udove J. Ullrich A. Press M.F. Science. 1989 ; 244: 707-712Crossref PubMed Scopus (6289) Google Scholar, 5Slamon D.J. Clark G.M. Wong S.G. Levin W.J. Ullrich A. McGuire W.L. Science. 1987 ; 235: 177-182Crossref PubMed Scopus (10014) Google Scholar, 6Nicholson R.I. McClelland R.A. Gee J.M. Manning D.L. Cannon P. Robertson J.F. Ellis I.O. Blamey R.W. Breast Cancer Res. Treat. 1994 ; 29: 117-125Crossref PubMed Scopus (172) Google Scholar). Le rôle critique de HER-2 dans l'oncogenèse épithéliale ainsi que sa surexpression sélective sur les tissus malins en font une cible idéale pour l'immunothérapie (7Disisis M.L. Cheever M.A. Adv. Cancer Res. 1997 ; 71: 343-371Crossref PubMed Google Scholar). Les anticorps monoclonaux dirigés contre HER-2 induisent des changements phénotypiques dans les cellules tumorales, notamment la modulation négative du récepteur HER2, l'inhibition de la croissance des cellules tumorales, la réversion de la résistance aux cytokines, la restauration des niveaux d'expression de la E-cadhérine et la réduction de la production du facteur de croissance endothélial vasculaire (8Sliwkowski M.X. Lofgren J.A. Lewis G.D. Hotaling T.E. Fendly B.M. Fox J.A. Semin. Oncol. 1999 ; 26: 60-70PubMed Google Scholar). L'anticorps humanisé anti-HER-2/neu trastuzumab (Herceptin ; Genentech, Inc., South San Francisco, CA) s'est avéré efficace dans les essais cliniques chez les patients atteints d'un cancer du sein métastatique associé à HER-2 (9Nahta R. Hortobagyi G.N. Esteva F.J. Oncologue. 2003 ; 8: 5-17Crossref PubMed Scopus (103) Google Scholar), et a des activités antitumorales à la fois en tant qu'agent unique et en combinaison avec la chimiothérapie (10Nabholtz J.M. Reese D.M. Lindsay M.A. Riva A. Clin. Cancer du sein. 2002 ; 3 : S75-S79Abstract Full Text PDF PubMed Scopus (35) Google Scholar). Les mécanismes moléculaires sous-jacents à ces effets inhibiteurs de croissance ne sont pas tout à fait clairs. Il existe des preuves que les anticorps dirigés contre HER-2 peuvent antagoniser les propriétés de signalisation de la croissance constitutive du système HER-2, mobiliser des cellules immunitaires pour attaquer la cible tumorale et augmenter la cytotoxicité induite par la chimiothérapie (8Sliwkowski M.X. Lofgren J.A. Lewis G.D. Hotaling T.E. Fendly B.M. Fox J.A. Semin. Oncol. 1999 ; 26: 60-70PubMed Google Scholar). L'application clinique du trastuzumab a montré son efficacité. Cependant, plusieurs inconvénients importants (génération d'anticorps anti-idiotypiques, distribution tissulaire inadéquate, taux nécessitant des perfusions multiples et donc le coût associé) limitent l'utilité des protocoles d'immunothérapie passive (11Dakappagari N.K. Pyles J. Parihar R. Carson W.E. Young D.C. Kaumaya P.T. J. Immunol. 2003 ; 170: 4242-4253Crossref PubMed Scopus (67) Google Scholar). D'autre part, la stratégie de vaccination est une option alternative qui peut provoquer des anticorps inhibiteurs de tumeurs endogènes, stimuler la mémoire immunologique et, par conséquent, procurer des avantages à long terme aux patients à moindre coût. L'utilisation d'un peptide ou d'une partie d'une protéine plutôt que d'une protéine entière comme vaccins peut contourner la tolérance contre l'auto-protéine HER-2 et induire une immunité à réaction croisée. Bien que de nombreux anticorps anti-HER-2 inhibent la prolifération des cellules cancéreuses, certains stimulent activement la croissance du cancer. Il est bien connu que différents effets biologiques sont associés à la spécificité épitopique des anticorps. L'isolement des épitopes reconnus par le trastuzumab, un anticorps monoclonal thérapeutique antitumoral dirigé contre HER-2, peut être utile dans le développement de vaccins à base de peptides capables de stimuler une réponse immunitaire dirigée contre les tumeurs. Le criblage de bibliothèques d'affichage de phages est une technique puissante qui a été utilisée dans des études de cartographie d'épitopes ou de ligands pour définir des peptides qui se lient à un anticorps ou à une molécule de récepteur donné (12Romanov V.I. Curr. Cancer Drug Targets. 2003 ; 3: 119-129Crossref PubMed Scopus (33) Google Scholar, 13Liu R. Enstrom A.M. Lam K.S. Exp. Hematol. 2003 ; 31: 11-30Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 14Yip Y.L. Ward R.L. Curr. Pharm. Biotechnol. 2002 ; 3: 29-43Crossref PubMed Scopus (15) Google Scholar, 15Aina O.H. Sroka T.C. Chen M.L. Lam K.S. Biopolymers. 2002 ; 66: 184-199Crossref PubMed Scopus (281) Google Scholar). Dans cette étude, nous avons utilisé une banque de peptides de phage display 12-mer pour identifier les peptides qui se lient au trastuzumab et avons testé leur activité immunitaire et biologique. Le criblage d'une banque peptidique de 12 mer présentée sur des phages filamenteux M13 a conduit à l'isolement du peptide H98 (LLGPYELWELSH). Des recherches plus approfondies ont montré que le peptide H98, imitant l'épitope de liaison sur HER-2 pour le trastuzumab, bloquait spécifiquement la liaison du trastuzumab à HER-2 et provoquait une réponse anticorps anti-HER-2 ainsi qu'une réponse immunitaire cellulaire chez la souris. Bien qu'aucune homologie de séquence n'ait été trouvée entre le mimotope et HER-2, étant donné la structure cristalline connue du domaine de liaison de HER-2 et du trastuzumab, nous avons constaté que le peptide H98 contribuait à un épitope conformationnel de HER-2. De plus, les deux derniers acides aminés à la terminaison C, et le troisième avec le quatrième acide aminé à la terminaison N de H98, étaient critiques pour la liaison de H98 au trastuzumab. De plus, MutN1, un mutant de H98, a amélioré la liaison du trastuzumab au pro-peptide. L'approche consistant à utiliser des bibliothèques de peptides d'affichage de phages pour révéler des épitopes conformationnels peut jouer un rôle important dans la recherche de l'activité immunitaire des mimotopes HER-2. Et le peptide isolé pourrait devenir un candidat vaccin pour le traitement des cancers associés à HER-2. Phage Library, Bacteria, Antibodies, Expression Vector, and Cells— The Phage Display Peptide Library Kit E8110S a été acheté chez New England Biolabs (Beverly, MA). La banque contenait 1,5 × 1013 pfu 1Les abréviations utilisées sont : pfu, unités formant plaque ; LB, bouillon Luria ; ELISA, dosage immunosorbant lié à une enzyme ; HRP, peroxydase de raifort ; MTT, bleu de thiazolyle (bromure de 3-(4,5-diméthylthiazol-2-yl)-2,5-diphényltétrazolium) ; DHFR, dihydrofolate réductase./ml avec une complexité de 2,7 × 109 transformants. Les peptides présentés ont été exprimés à l'extrémité N terminale de la protéine d'enveloppe pIII du coliphage filamenteux M13. La bibliothèque a été stockée dans une solution saline tamponnée au tris, pH 7,5, avec 50 % de glycérol. Le phage a été propagé dans la souche ER2738 d'Escherichia coli, qui a été fournie avec le kit. L'anticorps trastuzumab a été fourni par le Centre du cancer du sein de l'Hôpital du cancer de Beijing. L'anticorps anti-M13 conjugué à la peroxydase de raifort (HRP) et le système de fusion du gène de la glutathion S-transférase (GST) ont été achetés auprès d'Amersham Biosciences. Le système de fusion du gène de la dihydrofolate réductase (DHFR) a été acheté à Qiagen (Valence, CA). La lignée cellulaire du cancer du sein humain SKBR3 (American Type Culture Collection, Manassas, VA) a été cultivée dans le milieu modifié Eagle' s de Dulbecco (Hyclone), supplémenté avec 10% de sérum de veau foetal. La lignée cellulaire NIH3T3-ErbB2 (fournie par le Dr S. L. Sun, École d'oncologie de l'Université de Pékin) a été cultivée dans du milieu RPMI 1640 (Hyclone) supplémenté avec 10% de sérum de veau foetal. Le biopanning et la sélection des IgG normales du phage humain et du trastuzumab ont été immobilisés séparément sur des billes de protéine A-agarose (Amersham Biosciences). Les phages (1,5 × 1011 pfu) ont été préabsorbés sur des billes contenant des IgG humaines normales immobilisées pour éliminer tous les phages qui n'étaient pas spécifiquement réactifs avec le trastuzumab. Les phages, dilués dans une solution saline tamponnée au tris contenant 0,1 % de Tween 20, ont été incubés à 4 °C pendant 1 h avec du trastuzumab immobilisé. Les billes ont été lavées 5 fois avec 0,1% de solution saline tamponnée Tween 20/Tris. Ensuite, les phages qui se sont liés au complexe trastuzumab et billes ont été amplifiés par infection directe par E. coli ER2738. Les phages amplifiés ont été purifiés par précipitation avec 20% de polyéthylène glycol 8000 (PEG8000), 2,5 m NaCl et utilisés dans le cycle suivant. Trois tours de sélection ont été effectués. Après cela, des plaques individuelles ont été prélevées au hasard et soumises à une analyse par dosage immuno-enzymatique des phages (ELISA) et séquençage de l'ADN, après amplification dans E. coli ER2738. ELISA phagique - Au total, 300 clones phagiques ont été testés par ELISA pour la réactivité avec le trastuzumab. Un seul clone a été cultivé pendant 4,5 h dans 1 ml de bouillon Luria (LB) et agité à 37 °C. Les cellules bactériennes ont été filées vers le bas, et le surnageant contenant le phage a été ajouté aux puits d'une plaque de microtitration qui a été recouverte de 5 μg/ml de trastuzumab ou d'IgG normales humaines témoins dans du NaHCO3 0,1 m, pH 9,5, puis bloquée avec du lait écrémé à 5 % dans une solution saline tamponnée au Tris. La plaque a été incubée à température ambiante pendant 1 h et lavée 5 fois avec une solution saline tamponnée Tween/Tris à 0,05%. Les phages liés ont été détectés par incubation avec un anticorps anti-M13 conjugué à HRP (Amersham Biosciences) pendant 1 h, suivie d'un lavage et de l'ajout d'un substrat de peroxydase (o-phénylènediamine, 0,4 mg/ml) dans un tampon citrate-phosphate, pH 5,0, contenant 0,02% (v/v) H2O2. La réaction a été arrêtée avec 50 μl de H2SO4 à 12,5 %. A492 a été déterminé à l'aide d'un lecteur de microplaques (modèle Bio-Rad 550). Séquençage de l'ADN et synthèse des peptides - L'ADN du phage simple brin a été préparé à partir de 26 clones immunopositifs par des techniques standard telles que décrites dans le kit de la bibliothèque de peptides de présentation des phages et séquencées par Shenyou Biology Inc. (Shanghai, Chine). Des peptides représentant la séquence du clone positif H98 (LLGPYELWELSH) et un peptide aléatoire témoin non pertinent F56 (WHDPTPWWSWET) ont été synthétisés par Bio-Scientific Inc. (Xian, Chine). Expression du peptide GST recombinant et des protéines de fusion peptidiques DHFR dans E. coli-Pour détecter l'activité du peptide H98 de manière simple et pratique, des protéines de fusion GST-H98 et DHFR-H98 ont été préparées, respectivement. Pour fabriquer la protéine de fusion GST-H98, les fragments d'oligonucléotides sense (5′ -GATCCTTGTTGGGTCCGTATGAGTTGTGGAGCTTTCTCATTGAAAGCTTG) et antisense (5′ -TCGACAAGCTTTCAATGAAAGCTCCCACAACTCATACGGACCCAACAAG) codant pour le clone positif H98, avec codon stop, site HindIII et extrémités collantes de BamHI/SalI représentées par les nucléotides soulignés, ont été synthétisés par Sangon Company (Shanghai, Chine) et insérés au site BamHI et SalI du vecteur pGEX-4T-1 (Amersham Biosciences). Les ADN ligaturés ont été utilisés pour transformer les cellules BL21 d'E. coli. L'ADN des recombinants a été identifié par digestion avec HindIII et EcoRV, puis confirmé par analyse de séquence d'ADN. Toutes ces procédures ont été effectuées comme décrit par Sambrook et al. (16Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning : A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 5.3-6.59Google Scholar). La purification de l'ADN à partir de gels d'agarose a été réalisée avec un kit de purification d'ADN QIAquick (Qiagen, Valencia, CA). Pour la préparation des protéines de fusion GST-H98, des bactéries transformées ont été cultivées en milieu LB avec sélection d'ampicilline à une densité optique de 0,8 à 600 nm. Ensuite, l'isopropyl-1-thio-β-d-galactopyranoside de 0,5 mm a été ajouté et les cultures ont été incubées pendant 5 h à 30 °C. Les cellules ont été recueillies par centrifugation et remises en suspension dans 20 ml de solution saline tamponnée au phosphate (PBS) avec du fluorure de phénylméthanesulfonyle 1 mm et du lysozyme 1 mg/ml. Les suspensions cellulaires ont été soniquées pendant 1 min à un pouls de 20%. Après élimination du lysat par centrifugation à 12 000 tr/min pendant 10 min à 4 °C, la protéine de fusion GST-H98 a été purifiée avec des billes de glutathion selon les instructions du fabricant (Amersham Biosciences). Pour obtenir la protéine de fusion DHFR-H98, les fragments d'oligonucléotides sens et antisens tels que décrits ci-dessus ont été insérés aux sites BglII (la même extrémité collante que BamHI) et SalI du vecteur pQE-40 (Qiagen). Les ADN ligaturés ont été utilisés pour transformer les cellules d'E. coli SG13009. La protéine de fusion DHFR-H98 a été purifiée selon les instructions du fabricant (Qiagen). ELISA - La réactivité du trastuzumab avec la GST et la protéine de fusion GST-H98 a été testée par ELISA. Les plaques de microtitrage 96 puits ont été recouvertes de 5 μg/ml de protéine de fusion GST ou GST-H98 dans du NaHCO3 0,1 m, pH 9,5, puis bloquées avec du lait écrémé à 5 % dans du PBS. Les plaques ont été ajoutées à des dilutions de trastuzumab et maintenues pendant 2 h à température ambiante. Le trastuzumab lié a été détecté à l'aide d'un anticorps IgG anti-humain conjugué à HRP (Zhong Shan Co., Beijing, Chine) avec 0,4 mg/ml d'o-phénylènediamine comme substrat de peroxydase, comme décrit dans « Phage ELISA.» Western Blot - La réactivité du trastuzumab avec la protéine de fusion GST a également été testée par analyse Western blot. Deux μg de protéines de fusion GST, GST-H98, GST-HER-2 et DHFR-H98 ont été soumis à 12 % de SDS-PAGE et transférés à la nitrocellulose. Les protéines ont été sondées avec l'anticorps anti-GST pour détecter l'expression de la protéine de fusion GST. Ils ont également été sondés avec du trastuzumab ou un anticorps IgG humain. Après avoir été lavés, les filtres ont été incubés avec un anticorps secondaire conjugué HRP, puis développés avec un système d'électrochimiluminescence (ECL) (Amersham Biosciences). Test d'inhibition compétitive - Pour tester l'inhibition de la liaison du trastuzumab à HER-2, nous avons revêtu des plaques de microtitrage à 96 puits de 5 μg/ml de lysat de cellules NIH3T3-ErbB2 (qui a été préparé en lysant les cellules dans un tampon de lyse contenant 1 % de Triton X-100, 1 mm d'EDTA, 1 mm de fluorure de phénylméthanesulfonyle et 1 μg/ml d'aprotinine) ou de protéine de fusion GST-H98 dans du NaHCO3 à 0,1 m, pH 9,5. Ensuite, 0,5 μg/ml de trastuzumab a été mélangé à des dilutions de lysat cellulaire H98, F56, GST, GST-H98 et NIH3T3-ErbB2, et préincubé pendant 1 h à température ambiante, puis transféré sur les plaques. Le trastuzumab lié a été détecté par ELISA standard comme décrit ci-dessus. Les peptides ou protéines ont été testés à 0, 0,5, 5, 10 et 50 μg/ml. Chaque dilution a été testée en double. L'inhibition a été calculée en utilisant la formule suivante : (ATrastuzumab - ATrastuzumab avec protéine)/ATrastuzumab × 100 %. L'expérience a été répétée trois fois. Test de prolifération cellulaire avec MTT - La lignée cellulaire du cancer du sein humain SKBR3 surexprimant HER-2 a été ensemencée dans des plaques de microtitration à 96 puits à une densité de 1 × 104 cellules/puits. Après une nuit d'incubation à 37 °C, le milieu Eagle' s modifié de Dulbecco contenant soit 1 μg/ml de trastuzumab soit des IgG humaines normales avec ou sans dilutions de peptides a été ajouté aux puits dans un volume final de 150 μl. Tous les traitements ont été réalisés en triple. Les plaques ont été incubées à 37 °C pendant 3 jours. Le nombre de cellules vivantes a été mesuré à l'aide d'un test de prolifération cellulaire au bleu de thiazolyle (MTT, Sigma) en lisant A492. Le taux d'inhibition de la prolifération a été calculé par la formule suivante : (IgG humaine normale -ATrastuzumab +H98/F56)/IgG humaine normale × 100%. Immunisation - Des souris BALB/c âgées de six à huit semaines (achetées au Centre animalier de l'Académie médicale chinoise) ont été immunisées par voie sous-cutanée avec 40 μg de GST-H98 ou de GST seule qui a été émulsionnée dans l'adjuvant complet de Freund la première fois. Les souris ont été stimulées quatre fois avec l'antigène émulsionné dans l'adjuvant incomplet de Freund toutes les 3 semaines. Les sérums ont été pris le jour 0 (pré-immunitaire) et 7 jours après les troisième et cinquième vaccinations. Le niveau d'anticorps dans les sérums des souris immunisées a été déterminé par ELISA. Pour tester la réponse antipeptidique, des plaques de microtitration à 96 puits ont été recouvertes de 5 μg/ml de protéine de fusion DHFR-H98 dans du NaHCO3 0,1 m, pH 9,5, puis bloquées avec du lait écrémé à 5 % dans du PBS. Une dilution 1:1000 de sérums de souris a été ajoutée aux plaques, qui ont ensuite été maintenues pendant 2 h à température ambiante. L'anticorps lié a été détecté en utilisant un anticorps IgG anti-souris conjugué à HRP avec 0,4 mg/ml d'o-phénylènediamine comme substrat de la peroxydase. Pour tester la réponse anti-HER-2, des plaques de microtitrage à 96 puits ont été recouvertes de 1 × 104 cellules/puits de NIH3T3-ErbB2, puis bloquées avec du lait écrémé à 5 % dans du PBS. Une dilution 1:100 des sérums de souris a été ajoutée aux plaques et la réponse anti-HER-2 a été évaluée par des techniques standard telles que décrites ci-dessus. T Cell Proliferation Assay—Spleen cells from 2 randomly selected BALB/c mice, which were immunized 4 times with GST-H98 or GST-other peptide, were isolated according to the standard techniques on day 7 post-immunization (17Baral R.N. Saha A. Chatterjee S.K. Foon K.A. Krieg A.M. Weiner G.J. Bhattacharya-Chatterjee M. Cancer Immunol. Immunother. 2003 ; 52: 317-327Crossref PubMed Scopus (30) Google Scholar). Les plaques de microtitrage 96 puits ont été recouvertes du peptide H98 à différentes concentrations (0, 1, 10 et 100 μg/ml), puis lavées deux fois avec du PBS. Les splénocytes (2 × 105/puits) ont été cultivés dans la plaque 96 puits enrobée et incubés à 37 °C pendant 3 jours. Le nombre de cellules vivantes a été mesuré en utilisant le test de prolifération cellulaire au bleu de thiazolyle (MTT, Sigma) en lisant A492. Le pourcentage de prolifération a été calculé par la formule suivante : (AH98- Maltraité)/Maltraité × 100%. Chaque test a été effectué au moins en triple. L'expérience a été répétée deux fois. Déterminants structurels de la séquence de liaison et optimisation de la séquence d'acides aminés - Pour analyser les conditions minimales requises pour l'activité de liaison, une variété de peptides de troncature et de mutation ont été fusionnés avec la GST (Tableau I). Les protéines de fusion peptidiques H98 cycliques GST-troncées, GST-mutantes et GST-cycliques correspondantes ont été exprimées et purifiées comme décrit ci-dessus. La réactivité du trastuzumab avec ces peptides de fusion GST a été testée par ELISA et Western blot. Table ITruncations and mutants of peptide H98 Peptide H98 truncated at the N (N10 to N6), C (C10 to C6), or both N and C (M8 and M6) terminus, respectively. Les acides aminés mutants ainsi que des cystéines supplémentaires ont été montrés en gras et soulignés (MutN3-4, MutC1-2, MutN1-2, MutN1, H98 cyclique) .PeptideSéquence d'acides aminésH98LLGPYELWELSHN10LLGPYELWELN8LLGPYELWN6LLGPYEC10GPYELWELSHC8YELWELSHC6LWELSHM8GPYELWELM6PYELWEMutN3-4LLVAYELWELSHMutC1-2LLGPYELWELGAMutN1-2GAGPYELWELSHMutN1QLGPYELWELSHCyclic H98CLLGPYELWELSHC Open table in a new tab Phage Selection-To select the positive clones that bind to trastuzumab, a random 12-mer phage display peptide library composed of 1.5 × 1011 independent phage clones was preabsorbed by human serum IgG and then specifically absorbed with truzumab. Pour chaque biopanning, les phages ont été titrés pour le pfu dans les entrées et les sorties afin de déterminer le degré de sélection. Le nombre total de phages liés au trastuzumab est passé de 8,2 × 104 pfu au premier tour à 3,7 × 106 pfu au troisième tour. Spécificité de la liaison des peptides au trastuzumab et de leurs séquences - Après 3 cycles de sélection, environ 13,7 % (41/300) des clones de phages analysés présentaient une activité de liaison au trastuzumab (données non présentées). Nous avons séquencé 26 clones de phages positifs et 25 clones ont codé la séquence d'acides aminés identique (LLGPYELWELSH) nommée H98. Une seule séquence différente, H23 (HPRPYHHTLPLT), a été observée. Ces deux séquences sont considérablement différentes et n'ont pas de similitudes évidentes dans le motif. La liaison du trastuzumab à la protéine de fusion GST-H98 a également été démontrée par ELISA et Western blot. Pour cette expérience, l'oligonucléotide codant pour le peptide H98 a été exprimé comme une extension C-terminale de la protéine GST. Les résultats de l'ELISA ont montré que le trastuzumab pouvait se lier spécifiquement à la GST-H98 mais pas à la GST (Fig. 1). Comme le montre la Fig. 1, le trastuzumab a réagi avec la protéine de fusion GST contenant le H98, alors qu'aucune réaction n'a été obtenue avec la GST. Les résultats du transfert Western suggèrent également que le trastuzumab pourrait se lier spécifiquement à H98 (Fig. 2).Fig. 2Analyse par transfert Western de la liaison du trastuzumab au peptide. Différentes protéines de fusion GST ont été préparées comme décrit dans « Procédures expérimentales.« Des quantités égales (2 μg) de protéines ont été soumises à SDS-PAGE et transférées sur des membranes de nitrocellulose. Les protéines ont été sondées avec un anticorps anti-GST (panneau de droite) pour détecter l'expression des peptides de fusion GST, puis sondées avec du trastuzumab (panneau de gauche) ou des IgG sériques humaines (panneau du milieu). Lane 1, GST ; Lane 2, GST-H98 ; Lane 3, GST-HER-2 ; Lane 4, DHFR-H98.View Large Image Figure ViewerDownload Hi-res image Download (PPT) GST-H98 and Peptide H98 Inhibition of Trastuzumab Binding to HER-2—The results from the ELISA and Western blot above shown that peptide H98 bound to the variable regions of trastuzumab. Cependant, pour démontrer que H98 ressemblait à l'épitope de HER-2, nous avons dû montrer que H98 bloquait la liaison entre le trastuzumab et HER-2. Pour effectuer ces expériences, nous avons utilisé un ELISA dans lequel des anticorps et des inhibiteurs (GST-H98 ou peptide H98) ont été préincubés et plaqués sur les plaques de microtitration revêtues de HER-2. Cette analyse a révélé que GST-H98 et le peptide H98 inhibaient la liaison du trastuzumab à HER-2 de manière dose-dépendante, mais que la protéine GST et le peptide F56 non pertinent ne produisaient pas d'inhibition notable sur leur interaction (Fig. 3A). HER-2 Inhibition de la liaison du trastuzumab à la GST-H98 - Pour démontrer que le trastuzumab qui s'est lié à la GST-H98 ou au peptide H98 était spécifique de HER-2, nous avons utilisé HER-2 pour inhiber la liaison du trastuzumab à la GST-H98. Le trastuzumab a été prémélangé avec différentes dilutions de HER-2. Les résultats montrent que HER-2 inhibe significativement la liaison du trastuzumab au GST-H98 (Fig. 3B). Sur la Fig. 3B, la GST seule a également démontré une inhibition dépendante de la concentration sur la liaison du trastuzumab à la GST-H98, mais la protéine de fusion GST-H98 a doublé ou triplé l'effet d'inhibition, par rapport à la GST. Les résultats ont démontré que le peptide H98 jouait un rôle essentiel dans l'inhibition de la liaison du trastuzumab au GST-H98. Le peptide H98 a bloqué la fonction du trastuzumab sur l'inhibition de la croissance cellulaire - Le trastuzumab est bien connu pour inhiber la croissance des cellules cancéreuses du sein par interaction avec HER-2. Parce que le peptide H98 a la capacité de bloquer l'interaction entre le trastuzumab et HER-2, nous avons donc décidé de tester si le peptide H98 affecte la capacité du trastuzumab à inhiber la croissance cellulaire. Comme le montre la figure 4, la réponse des cellules cancéreuses du sein SKBR3 au trastuzumab était significativement bloquée par le peptide H98 de manière dose-dépendante et le taux de blocage de 50 % était atteint lorsque le peptide H98 était présent à une concentration de 60 μg/ml, alors qu'une concentration équivalente du peptide témoin n'avait aucun effet significatif sur l'inhibition de la croissance cellulaire. Souris immunisées avec des anticorps anti-HER-2 fabriqués par GST-H98 - Le peptide H98 a été exprimé en tant que protéine de fusion GST (GST-H98), et les immunogénicités ont été évaluées chez la souris. Quatre souris sur 5 immunisées avec un anticorps spécifique du peptide généré par GST-H98 (Fig. 5A) ainsi que l'anticorps contre HER-2 (Fig. 5B) après la cinquième vaccination. La réponse anti-HER-2 était inférieure à la réponse anti-peptide, et la réponse anti-peptide H98 pouvait être détectée plus tôt que la réponse anti-HER-2. Aucune réponse antipeptidique ou anti-HER-2 n'a été observée chez les souris immunisées avec la GST. L'une des 5 souris a généré un anticorps contre HER-2 qui a pu être détecté dans un test d'immunoprécipitation par Western blot (données non présentées). Développement de la réponse immunitaire cellulaire - L'immunité cellulaire induite chez les souris qui ont été immunisées avec GST-H98 ou GST-autres peptides a été évaluée avec le test de prolifération des lymphocytes T. Les rates de deux souris ont été isolées pour être utilisées dans ce test. La prolifération des lymphocytes T a été testée comme décrit sous « Procédures expérimentales » en utilisant H98 comme stimulant. Les résultats présentés dans la Fig. 6 indiquent que la prolifération des lymphocytes T a eu lieu chez des souris immunisées avec GST-H98 mais pas chez des souris immunisées avec un autre peptide GST. Déterminants structurels de la liaison de H98 au trastuzumab - La diminution de la longueur des peptides peut simplifier les modifications de la séquence peptidique, ainsi que fournir une indication des caractéristiques de la fente de liaison. Les résultats ELISA et Western blot ont montré que parmi 15 types de GST-H98, y compris la protéine de fusion peptidique tronquée et mutante de la GST, seuls GST-H98, GST-C10, GST-MutN1-2, GST-MutN1 et GST-cyclique H98 étaient capables de se lier spécifiquement au trastuzumab (Fig. 7 et 8).Fig. 8Western blot analysis of trastuzumab binding to different GST peptide fusion proteins. Les protéines de fusion GST ont été préparées comme décrit dans « Procédures expérimentales.« Des quantités égales (2 μg) de protéines ont été soumises à SDS-PAGE et transférées sur des membranes de nitrocellulose. L'anticorps anti-GST (panneau supérieur)ou le trastuzumab (panneau inférieur) ont été utilisés séparément en tant que premiers anticorps, et un anticorps secondaire conjugué à HRP a été appliqué pour détecter les réactions protéiques comme décrit dans la section « Procédures expérimentales ».» Lane 1, GST ; Lane 2, GST-H98 ; Lane 3, GST-N10 ; Lane 4, GST-N8 ; Lane 5, GST-N6 ; Lane 6, GST-C10 ; Lane 7, GST-C8 ; Lane 8, GST-C6 ; Lane 9, GST-M8 ; Lane 10, GST-M6 ; Lane 11, GST-MutN3-4 ; Lane 12, GST-MutC1-2 ; Lane 13, GST-MutN1-2 ; Lane 14, GST-MutN1 ; Lane 15, GST-cyclic H98.View Large Image ViewerDownload Hi-res image Download (PPT) Comme le montrent les Figures 7 et 8, GST-MutN3-4 (mutant de GP N-terminal à VA) et GST-C8 ne pouvaient pas se lier au trastuzumab, mais GST-C10 pouvait se lier au trastuzumab. Ces différences dans les capacités de liaison impliquent que les troisième et quatrième acides aminés, glycine (Gly) et Proline (Pro), à l'extrémité N terminale étaient essentiels pour l'activité du peptide H98. De plus, ni GST-MutC1–2 (mutant de C-terminal SH à GA) ni GST-N10 ne pouvaient se lier au trastuzumab, ce qui suggérait que la sérine (Ser) et l'histidine (His) à l'extrémité C terminale étaient également essentielles pour conserver une activité complète de liaison aux peptides. Alternativement, la capacité de GST-MutN1-2 à se lier au trastuzumab était significativement altérée mais pas complètement abolie, ce qui impliquait que les deux premières leucines (LL) à l'extrémité N terminale n'étaient pas très importantes pour l'activité de liaison de H98 mais étaient susceptibles d'avoir un effet sur la formation de la structure marginale du peptide. Une délétion supplémentaire de 4 ou 6 résidus à la terminaison N ou C a complètement aboli la capacité du peptide H98 à se lier au trastuzumab. Ainsi, il apparaît que le peptide doit avoir une longueur supérieure à 8 acides aminés pour satisfaire aux exigences de liaison. Accord

Translated Description (Spanish)

Se ha demostrado que trastuzumab, un anticuerpo humanizado contra HER-2, es eficaz en el tratamiento del cáncer de mama en el que se produce la sobreexpresión y metástasis de HER-2. En nuestra búsqueda de un epítopo mimético eficaz de la unión de HER-2 con trastuzumab y para desarrollar una vacuna de péptido HER-2, seleccionamos una biblioteca de péptidos 12-mer de presentación en fagos con trastuzumab como objetivo. Se aisló un péptido mimético (mimótopo) H98 (LLGPYELWELSH) que podía reconocer específicamente trastuzumab. El ADN que codifica el péptido H98 se clonó y se expresó como la proteína de fusión GST-H98 en Escherichia coli BL21. La GST-H98 purificada podría unirse específicamente a trastuzumab y bloquear la unión de trastuzumab a la proteína HER-2. Además, H98 podría bloquear significativamente la función de trastuzumab inhibiendo el crecimiento de células cancerosas. Los ratones que se inmunizaron con GST-H98 produjeron anticuerpos específicos contra H98, así como contra HER-2. Además, la proliferación de células T ocurrió en ratones inmunizados con GST-H98. Aunque no se encontró homología de secuencia entre H98 y HER-2, mediante el uso de análisis de estructura pudimos determinar que el péptido H98 contribuyó a un epítopo conformacional de HER-2. Además, determinamos que los dos últimos aminoácidos en el extremo C, y el tercero junto con el cuarto aminoácido en el extremo N del péptido H98 son críticos para la unión de H98 a trastuzumab. Como resultado, concluimos que el péptido H98 tiene potencial para desarrollarse como una vacuna HER-2 para la bioterapia del cáncer con sobreexpresión de HER-2. Se ha demostrado que trastuzumab, un anticuerpo humanizado contra HER-2, es eficaz en el tratamiento del cáncer de mama en el que se produce la sobreexpresión y metástasis de HER-2. En nuestra búsqueda de un epítopo mimético eficaz de la unión de HER-2 con trastuzumab y para desarrollar una vacuna de péptido HER-2, seleccionamos una biblioteca de péptidos 12-mer de presentación en fagos con trastuzumab como objetivo. Se aisló un péptido mimético (mimótopo) H98 (LLGPYELWELSH) que podía reconocer específicamente trastuzumab. El ADN que codifica el péptido H98 se clonó y se expresó como la proteína de fusión GST-H98 en Escherichia coli BL21. La GST-H98 purificada podría unirse específicamente a trastuzumab y bloquear la unión de trastuzumab a la proteína HER-2. Además, H98 podría bloquear significativamente la función de trastuzumab inhibiendo el crecimiento de células cancerosas. Los ratones que se inmunizaron con GST-H98 produjeron anticuerpos específicos contra H98, así como contra HER-2. Además, la proliferación de células T ocurrió en ratones inmunizados con GST-H98. Aunque no se encontró homología de secuencia entre H98 y HER-2, mediante el uso de análisis de estructura pudimos determinar que el péptido H98 contribuyó a un epítopo conformacional de HER-2. Además, determinamos que los dos últimos aminoácidos en el extremo C, y el tercero junto con el cuarto aminoácido en el extremo N del péptido H98 son críticos para la unión de H98 a trastuzumab. Como resultado, concluimos que el péptido H98 tiene potencial para desarrollarse como una vacuna HER-2 para la bioterapia del cáncer con sobreexpresión de HER-2. HER-2 (también conocido como Neu o ErbB-2) es un miembro de la familia de receptores del factor de crecimiento epidérmico (también conocido como HER) de tirosina quinasa receptora (1Yarden Y. Sliwkowski M.X. Nat. Rev. Mol. Cell. Biol. 2001; 2: 127-137 Crossref PubMed Scopus (5670) Google Scholar). SUS receptores son mediadores esenciales de la proliferación y diferenciación celular en el embrión en desarrollo y en los tejidos adultos (2Olayioye M.A. Neve R.M. Lane H.A. Hynes N.E. EMBO J. 2000; 19: 3159-3167Crossref PubMed Google Scholar). La sobreexpresión del oncogén HER-2 es un evento molecular frecuente en múltiples cánceres humanos, incluidos los carcinomas de mama, ovario, gástrico y colorrectal (3Wang S.C. Zhang L. Hortobagyi G.N. Hung M.C. Semin. Oncol. 2001; 28: 21-29Crossref PubMed Google Scholar). En pacientes con cáncer de mama, la sobreexpresión de HER-2 es un predictor independiente de supervivencia. Se asocia con mal pronóstico, enfermedad agresiva, resistencia a la quimioterapia y terapia hormonal (4Slamon D.J. Godolphin W. Jones L.A. Holt J.A. Wong S.G. Keith D.E. Levin W.J. Stuart S.G. Udove J. Ullrich A. Press M.F. Science. 1989; 244: 707-712Crossref PubMed Scopus (6289) Google Scholar, 5Slamon D.J. Clark G.M. Wong S.G. Levin W.J. Ullrich A. McGuire W.L. Science. 1987; 235: 177-182Crossref PubMed Scopus (10014) Google Scholar, 6Nicholson R.I. McClelland R.A. Gee J.M. Manning D.L. Cannon P. Robertson J.F. Ellis I.O. BLAMEY R.W. Breast Cancer Res. Treat. 1994; 29: 117-125 Crossref PubMed Scopus (172) Google Scholar). El papel crítico de HER-2 en la oncogénesis epitelial, así como su sobreexpresión selectiva en tejidos malignos, lo convierte en un objetivo ideal para la inmunoterapia (7Disis M.L. Cheever M.A. Adv. Cancer Res. 1997; 71: 343-371Crossref PubMed Google Scholar). Los anticuerpos monoclonales dirigidos a HER-2 inducen cambios fenotípicos en las células tumorales, incluida la modulación por disminución del receptor HER2, la inhibición del crecimiento de las células tumorales, la reversión de la resistencia a las citocinas, la restauración de los niveles de expresión de E-cadherina y la reducción de la producción del factor de crecimiento endotelial vascular (8Sliwkowski M.X. Lofgren J.A. Lewis G.D. Hotaling T.E. Fendly B.M. Fox J.A. Semin. Oncol. 1999; 26: 60-70PubMed Google Scholar). El anticuerpo humanizado anti-HER-2/neu trastuzumab (Herceptin; Genentech, Inc., South San Francisco, CA) ha demostrado ser eficaz en ensayos clínicos en pacientes con cáncer de mama metastásico asociado a HER-2 (9Nahta R. Hortobagyi G.N. Esteva F.J. Oncologist. 2003; 8: 5-17 Crossref PubMed Scopus (103) Google Scholar), y tiene actividades antitumorales como agente único y en combinación con quimioterapia (10Nabholtz J.M. Reese D.M. Lindsay M.A. Riva A. Clin. Breast Cancer. 2002; 3: S75-S79Abstract Full Text PDF PubMed Scopus (35) Google Scholar). Los mecanismos moleculares que subyacen a estos efectos inhibidores del crecimiento no están del todo claros. Existe alguna evidencia de que los anticuerpos contra HER-2 pueden antagonizar las propiedades de señalización de crecimiento constitutivo del sistema HER-2, reclutar células inmunitarias para atacar el objetivo tumoral y aumentar la citotoxicidad inducida por la quimioterapia (8Sliwkowski M.X. Lofgren J.A. Lewis G.D. Hotaling T.E. Fendly B.M. Fox J.A. Semin. Oncol. 1999; 26: 60-70PubMed Google Scholar). La aplicación clínica de trastuzumab ha demostrado eficacia. Sin embargo, varios inconvenientes importantes (generación de anticuerpos antiidiotípicos, distribución tisular inadecuada, niveles que requieren infusiones múltiples y, por lo tanto, el costo asociado) limitan la utilidad de los protocolos de inmunoterapia pasiva (11Dakappagari N.K. Pyles J. Parihar R. Carson W.E. Young D.C. Kaumaya P.T. J. Immunol. 2003; 170: 4242-4253 Crossref PubMed Scopus (67) Google Scholar). Por otro lado, la estrategia de vacunación es una opción alternativa que puede provocar anticuerpos inhibidores de tumores endógenos, estimular la memoria inmunológica y, en consecuencia, proporcionar beneficios a largo plazo a los pacientes a costos más bajos. El uso de un péptido o parte de una proteína en lugar de una proteína completa como vacunas puede eludir la tolerancia contra la autoproteína HER-2 e inducir inmunidad de reacción cruzada. Aunque muchos anticuerpos anti-HER-2 inhiben la proliferación de células cancerosas, algunos estimulan activamente el crecimiento del cáncer. Es bien sabido que diferentes efectos biológicos están asociados con la especificidad del epítopo de los anticuerpos. El aislamiento de epítopos reconocidos por trastuzumab, un anticuerpo monoclonal terapéutico antitumoral dirigido contra HER-2, puede ser útil en el desarrollo de vacunas basadas en péptidos que sean capaces de estimular una respuesta inmune dirigida a tumores. El cribado de bibliotecas de expresión en fagos es una técnica poderosa que se ha utilizado en estudios de mapeo de epítopos o ligandos para definir péptidos que se unen a un anticuerpo o molécula receptora dado (12Romanov V.I. Curr. Cancer Drug Targets. 2003; 3: 119-129Crossref PubMed Scopus (33) Google Scholar, 13Liu R. Enstrom A.M. Lam K.S. Exp. Hematol. 2003; 31: 11-30Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 14Yip Y.L. Ward R.L. Curr. Pharm. Biotechnol. 2002; 3: 29-43Crossref PubMed Scopus (15) Google Scholar, 15Aina O.H. Sroka T.C. Chen M.L. Lam K.S. Biopolymers. 2002; 66: 184-199 Crossref PubMed Scopus (281) Google Scholar). En este estudio, utilizamos una biblioteca de péptidos 12-mer de presentación en fagos para identificar péptidos que se unen a trastuzumab y probamos su actividad inmunitaria y biológica. El cribado de una biblioteca de péptidos 12-mer presentada en fagos filamentosos M13 condujo al aislamiento del péptido H98 (LLGPYELWELSH). Investigaciones adicionales mostraron que el péptido H98, que imita el epítopo de unión en HER-2 para trastuzumab, bloqueó específicamente la unión de trastuzumab a HER-2 y provocó una respuesta de anticuerpos anti-HER-2, así como una respuesta inmune celular en ratones. Aunque no se encontró homología de secuencia entre el mimótopo y HER-2, dada la estructura cristalina conocida del dominio de unión de HER-2 y trastuzumab, encontramos que el péptido H98 contribuyó a un epítopo conformacional de HER-2. Además, los dos últimos aminoácidos en el extremo C, y el tercero junto con el cuarto aminoácido en el extremo N de H98, fueron críticos para la unión de H98 a trastuzumab. Además, MutN1, un mutante de H98, mejoró la unión de trastuzumab al propéptido. El enfoque de utilizar bibliotecas de péptidos de presentación en fagos para revelar epítopos conformacionales puede desempeñar un papel importante en la investigación de la actividad inmunitaria de los mimótopos de HER-2. Y el péptido aislado podría convertirse en un candidato como vacuna para el tratamiento de cánceres asociados a HER-2. Biblioteca de fagos, bacterias, anticuerpos, vector de expresión y células: el kit de biblioteca de péptidos de presentación de fagos Ph.D.-12 E8110S se adquirió de New England Biolabs (Beverly, MA). La biblioteca contenía 1.5 × 1013 pfu 1Las abreviaturas utilizadas son: pfu, unidades formadoras de placa; LB, caldo Luria; ELISA, ensayo inmunoabsorbente ligado a enzimas; HRP, peroxidasa de rábano picante; MTT, azul de tiazolilo (bromuro de 3-(4,5-dimetiltiazol-2-il)-2,5-difeniltetrazolio); DHFR, dihidrofolato reductasa./ml con una complejidad de 2.7 × 109 transformantes. Los péptidos presentados se expresaron en el extremo N de la proteína de cubierta pIII del colifago filamentoso M13. La biblioteca se almacenó en solución salina tamponada con Tris, pH 7,5, con glicerol al 50%. El fago se propagó en la cepa ER2738 de Escherichia coli, que se proporcionó con el kit. El Centro de Cáncer de Mama del Hospital Oncológico de Beijing proporcionó el anticuerpo trastuzumab. El anticuerpo anti-M13 conjugado con peroxidasa de rábano picante (HRP) y el sistema de fusión del gen de la glutatión S-transferasa (GST) se adquirieron de Amersham Biosciences. El sistema de fusión del gen de la dihidrofolato reductasa (DHFR) se adquirió de Qiagen (Valencia, CA). La línea celular de cáncer de mama humano SKBR3 (American Type Culture Collection, Manassas, VA) se cultivó en medio de Eagle modificado por Dulbecco (Hyclone), complementado con suero de ternera fetal al 10%. La línea celular NIH3T3-ErbB2 (proporcionada por el Dr. SL Sun, Escuela de Oncología de la Universidad de Pekín) se cultivó en medio RPMI 1640 (Hyclone) complementado con suero fetal de ternera al 10%. Análisis biológico y selección de fagos: se inmovilizaron por separado IgG normal humana y trastuzumab en perlas de proteína A-agarosa (Amersham Biosciences). Los fagos (1.5 × 1011 pfu) se preabsorbieron en perlas que contenían IgG normal humana inmovilizada para eliminar cualquier fago que no fuera específicamente reactivo con trastuzumab. Los fagos, diluidos en solución salina tamponada con Tris que contenía Tween 20 al 0,1%, se incubaron a 4 °C durante 1 h con trastuzumab inmovilizado. Las perlas se lavaron 5 veces con solución salina tamponada con 0,1% de Tween 20/Tris. Luego, los fagos que se unieron con trastuzumab y el complejo de perlas se amplificaron mediante infección directa con E. coli ER2738. Los fagos amplificados se purificaron mediante precipitación con polietilenglicol 8000 al 20% (PEG8000), NaCl 2,5 m y se utilizaron en el siguiente ciclo. Se realizaron tres rondas de selección. Después de eso, las placas individuales se recogieron aleatoriamente y se sometieron a análisis mediante ensayo de inmunoabsorción ligado a enzimas de fagos (ELISA) y secuenciación de ADN, después de la amplificación en E. coli ER2738. ELISA de fagos: en total, se analizaron 300 clones de fagos para determinar la reactividad con trastuzumab mediante ELISA. Se cultivó un solo clon durante 4,5 h en 1 ml de caldo Luria (LB) y se agitó a 37 °C. Las células bacterianas se centrifugaron, y el sobrenadante que contenía el fago se añadió a los pocillos de una placa de microtitulación que se recubrió con 5 μg/ml de trastuzumab o IgG humana normal de control en NaHCO3 0,1 m, pH 9,5, y luego se bloqueó con leche desnatada al 5% en solución salina tamponada con Tris. La placa se incubó a temperatura ambiente durante 1 h y se lavó 5 veces con solución salina tamponada con Tween/Tris al 0,05%. Los fagos unidos se detectaron mediante incubación con anticuerpo anti-M13 conjugado con HRP (Amersham Biosciences) durante 1 h, seguido de lavado y la adición de un sustrato de peroxidasa (o-fenilendiamina, 0,4 mg/ml) en tampón citrato-fosfato, pH 5,0, que contenía H2O2 al 0,02% (v/v). La reacción se detuvo con 50 μl de H2SO4 al 12,5%. A492 se determinó utilizando un lector de microplacas (Bio-Rad modelo 550). Secuenciación de ADN y síntesis de péptidos: se preparó ADN de fago monocatenario a partir de 26 clones inmunopositivos mediante técnicas estándar como se describe en el kit de biblioteca de péptidos de presentación en fagos y se secuenció por Shenyou Biology Inc. (Shanghai, China). Los péptidos que representan la secuencia del clon positivo H98 (LLGPYELWELSH) y un péptido aleatorio de control irrelevante F56 (WHDPTPWWSWET) fueron sintetizados por Bio-Scientific Inc. (Xian, China). Expresión del péptido GST recombinante y las proteínas de fusión del péptido DHFR en E. coli Para detectar la actividad del péptido H98 de manera simple y conveniente, se prepararon las proteínas de fusión GST-H98 y DHFR-H98, respectivamente. Para elaborar la proteína de fusión GST-H98, los fragmentos de oligonucleótidos sentido (5′ -GATCCTTGTTGGGTCCGTATGAGTTGTGGGAGCTTTCTCATTGAAAGCTTG) y antisentido (5′ -TCGACAAGCTTTCAATGAGAAAGCTCCCACAACTCATACGGACCCAACAAG) que codifican el clon positivo H98, con codón de terminación, sitio HindIII y extremos pegajosos de BamHI/SalI mostrados por los nucleótidos subrayados, fueron sintetizados por Sangon Company (Shanghai, China) e insertados en el sitio BamHI y SalI del vector pGEX-4T-1 (Amersham Biosciences). Los ADN ligados se utilizaron para transformar células BL21 de E. coli. El ADN de los recombinantes se identificó mediante digestión con HindIII y EcoRV y luego se confirmó mediante análisis de secuencia de ADN. Todos estos procedimientos se llevaron a cabo como se describe en Sambrook et al. (16Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 5.3-6.59 Google Scholar). La purificación de ADN a partir de geles de agarosa se realizó con un kit de purificación de ADN QIAquick (Qiagen, Valencia, CA). Para la preparación de proteínas de fusión GST-H98, las bacterias transformadas se cultivaron en medio LB con selección de ampicilina a una densidad óptica de 0.8 a 600 nm. A continuación, se añadió isopropil-1-tio-β-d-galactopiranósido 0,5 mm y los cultivos se incubaron adicionalmente durante 5 h a 30 °C. Las células se recogieron por centrifugación y se resuspendieron en 20 ml de solución salina tamponada con fosfato (PBS) con fluoruro de fenilmetanosulfonilo 1 mm y 1 mg/ml de lisozima. Las suspensiones celulares se sonicaron durante 1 min a un pulso del 20%. Después de que el lisado se aclaró mediante centrifugación a 12.000 rpm durante 10 min a 4 °C, la proteína de fusión GST-H98 se purificó con perlas de glutatión de acuerdo con las instrucciones del fabricante (Amersham Biosciences). Para obtener la proteína de fusión DHFR-H98, los fragmentos de oligonucleótidos sentido y antisentido como se describió anteriormente se insertaron en los sitios BglII (el mismo extremo pegajoso que BamHI) y SalI del vector pQE-40 (Qiagen). Los ADN ligados se utilizaron para transformar células de E. coli SG13009. La proteína de fusión DHFR-H98 se purificó de acuerdo con las instrucciones del fabricante (Qiagen). ELISA: la reactividad de trastuzumab con GST y la proteína de fusión GST-H98 se probó mediante ELISA. Las placas de microtitulación de 96 pocillos se recubrieron con 5 μg/ml de proteína de fusión GST o GST-H98 en 0.1 m NaHCO3, pH 9.5, luego se bloquearon con leche desnatada al 5% en PBS. Las placas se añadieron a diluciones de trastuzumab y se mantuvieron durante 2 h a temperatura ambiente. El trastuzumab unido se detectó utilizando anticuerpo IgG anti-humano conjugado con HRP (Zhong Shan Co., Beijing, China) con 0.4 mg/ml de o-fenilendiamina como sustrato de peroxidasa, como se describe en "Phage ELISA." Western Blot: la reactividad de trastuzumab con la proteína de fusión GST también se probó mediante análisis de Western blot. Se sometieron dos μg de proteínas de fusión GST, GST-H98, GST-HER-2 y DHFR-H98 a SDS-PAGE al 12% y se transfirieron a nitrocelulosa. Las proteínas se sondaron con el anticuerpo anti-GST para detectar la expresión de la proteína de fusión GST. También se probaron con trastuzumab o anticuerpo IgG humano. Después de lavarse, los filtros se incubaron con anticuerpo secundario conjugado con HRP y luego se desarrollaron con un sistema de electroquimioluminiscencia (ECL) (Amersham Biosciences). Ensayo de inhibición competitiva: para probar la inhibición de la unión de trastuzumab a HER-2, recubrimos placas de microtitulación de 96 pocillos con 5 μg/ml de lisado celular NIH3T3-ErbB2 (que se preparó lisando las células en tampón de lisis que contenía Triton X-100 al 1%, EDTA 1 mm, fluoruro de fenilmetanosulfonilo 1 mm y aprotinina 1 μg/ml) o proteína de fusión GST-H98 en NaHCO3 0,1 m, pH 9,5. A continuación, se mezcló 0,5 μg/ml de trastuzumab con diluciones de lisado celular H98, F56, GST, GST-H98 y NIH3T3-ErbB2, y se preincubó durante 1 h a temperatura ambiente, y luego se transfirió a las placas. El trastuzumab unido se detectó mediante ELISA estándar como se describió anteriormente. Los péptidos o proteínas se analizaron a 0, 0,5, 5, 10 y 50 μg/ml. Cada dilución se probó por duplicado. La inhibición se calculó utilizando la siguiente fórmula: (ATrastuzumab - ATrastuzumab con proteína)/ATrastuzumab × 100%. El experimento se repitió tres veces. Ensayo de proliferación celular con MTT: la línea celular de cáncer de mama humano SKBR3 que sobreexpresa HER-2 se sembró en placas de microtitulación de 96 pocillos a una densidad de 1 x 104 células/pocillo. Después de la incubación durante la noche a 37 °C, se añadió medio de Eagle modificado por Dulbecco que contenía 1 μg/ml de trastuzumab o IgG humana normal con o sin diluciones de péptidos a los pocillos en un volumen final de 150 μl. Todos los tratamientos se realizaron por triplicado. Las placas se incubaron a 37 °C durante 3 días. El número de células vivas se midió utilizando un ensayo de proliferación celular de azul de tiazolilo (MTT, Sigma) mediante la lectura de A492. La tasa de inhibición de la proliferación se calculó mediante la fórmula siguiente: (IgG normal AHumana - ATrastuzumab+H98/F56)/IgG normal AHumana × 100%. Inmunización - Se inmunizaron ratones BALB/c de seis a 8 semanas de edad (adquiridos en el Animal Center de la Academia Médica China) por vía subcutánea con 40 μg de GST-H98 o GST solo que se emulsionó en adyuvante completo de Freund la primera vez. Los ratones se reforzaron cuatro veces con el antígeno emulsionado en adyuvante incompleto de Freund cada 3 semanas. Los sueros se tomaron el día 0 (preinmune) y 7 días después de la tercera y quinta inmunización. El nivel de anticuerpos en los sueros de ratones inmunizados se determinó mediante ELISA. Para probar la respuesta antipéptido, se recubrieron placas de microtitulación de 96 pocillos con 5 μg/ml de proteína de fusión DHFR-H98 en 0.1 m NaHCO3, pH 9.5, y luego se bloquearon con leche desnatada al 5% en PBS. Se añadió una dilución 1:1000 de sueros de ratones a las placas, que luego se mantuvieron durante 2 h a temperatura ambiente. El anticuerpo unido se detectó mediante el uso de anticuerpo IgG anti-ratón conjugado con HRP con 0.4 mg/ml de o-fenilendiamina como sustrato de peroxidasa. Para probar la respuesta anti-HER-2, se recubrieron placas de microtitulación de 96 pocillos con 1 × 104 células/pocillo de NIH3T3-ErbB2 y luego se bloquearon con leche desnatada al 5% en PBS. Se añadió una dilución 1:100 de sueros de ratones a las placas y se evaluó la respuesta anti-HER-2 mediante técnicas estándar como se describió anteriormente. Ensayo de proliferación de células T: se aislaron células de bazo de 2 ratones BALB/c seleccionados al azar, que se inmunizaron 4 veces con GST-H98 u otro péptido de GST, de acuerdo con las técnicas estándar el día 7 después de la inmunización (17Baral R.N. Saha A. Chatterjee S.K. Foon K.A. Krieg A.M. Weiner G.J. Bhattacharya-Chatterjee M. Cancer Immunol. Immunother. 2003; 52: 317-327Crossref PubMed Scopus (30) Google Scholar). Las placas de microtitulación de 96 pocillos se recubrieron con péptido H98 a diferentes concentraciones (0, 1, 10 y 100 μg/ml) y luego se lavaron dos veces con PBS. Los esplenocitos (2 × 105/pocillo) se cultivaron en la placa de 96 pocillos recubierta y se incubaron a 37 °C durante 3 días. El número de células vivas se midió utilizando el ensayo de proliferación celular de azul de tiazolilo (MTT, Sigma) mediante la lectura de A492. El porcentaje de proliferación se calculó mediante la fórmula siguiente: (AH98- Auntreated)/Auntreated × 100%. Cada ensayo se realizó al menos por triplicado. El experimento se repitió dos veces. Determinantes estructurales de la secuencia de unión y optimización de la secuencia de aminoácidos: para analizar los requisitos mínimos para la actividad de unión, se fusionaron una variedad de péptidos de truncamiento y mutación con GST (Tabla I). Las proteínas de fusión de GST-truncado, GST-mutante y GST-péptido cíclico H98 correspondientes se expresaron y purificaron como se describió anteriormente. La reactividad de trastuzumab con estos péptidos de fusión de GST se probó mediante ELISA y transferencia Western. Los truncamientos de la tabla y los mutantes del péptido H98 El péptido H98 truncado en el extremo N (N10 a N6), C (C10 a C6) o tanto N como C (M8 y M6), respectivamente. Los aminoácidos mutantes, así como las cisteínas adicionales, se mostraron en negrita y subrayados (MutN3-4, MutC1-2, MutN1-2, MutN1, H98 cíclico) .Secuencia de aminoácidosH98LLGPYELWELSHN10LLGPYELWELN8LLGPYELWN6LLGPYEC10GPYELWELSHC8YELWELSHC6LWELSHM8GPYELWELM6PYELWEMutN3-4LLVAYELWELSHMutC1-2LLGPYELWELGAMutN1-2GAGPYELWELSHMutN1QLGPYELWELSHCyclic H98CLLGPYELWELSHC Tabla abierta en una nueva selección de fagos Tab: para seleccionar los clones positivos que se unen a trastuzumab, una biblioteca de péptidos de exhibición de 12 fagos aleatorios compuesta por 1.5 × 1011 clones de fagos independientes fue preabsorbida por IgG humana y luego absorbida específicamente con trastuzumab. Para cada biocribado, los fagos se titularon para pfu en las entradas y salidas para determinar el grado de selección. El número total de fagos unidos a trastuzumab aumentó de 8.2 × 104 pfu en la primera ronda a 3.7 × 106 pfu en la tercera ronda. Especificidad de la unión de péptidos a trastuzumab y sus secuencias: después de 3 rondas de selección, aproximadamente el 13,7% (41/300) de los clones de fagos analizados mostraron actividad de unión a trastuzumab (datos no mostrados). Secuenciamos 26 clones de fagos positivos y 25 clones codificaron la secuencia de aminoácidos idéntica (LLGPYELWELSH) llamada H98. Solo se observó una secuencia diferente, H23 (HPRPYHHTLPLT). Estas dos secuencias son considerablemente diferentes y no tienen similitudes obvias en el motivo. La unión de trastuzumab a la proteína de fusión GST-H98 también se demostró mediante ELISA y transferencia Western. Para este experimento, el oligonucleótido que codifica el péptido H98 se expresó como una extensión C-terminal de la proteína GST. Los resultados del ELISA mostraron que trastuzumab podría unirse específicamente a GST-H98 pero no a GST (Fig. 1). Como se muestra en la Fig. 1, trastuzumab reaccionó con la proteína de fusión GST que contiene el H98, mientras que no se obtuvo ninguna reacción con GST. Los resultados de la transferencia Western también sugirieron que trastuzumab podría unirse específicamente a H98 (Fig. 2).Fig. 2Análisis de transferencia Western de la unión de trastuzumab al péptido. Se prepararon diferentes proteínas de fusión GST como se describe en "Procedimientos experimentales.Se sometieron cantidades iguales (2 μg) de proteínas a SDS-PAGE y se transfirieron a membranas de nitrocelulosa. Las proteínas se sondaron con anticuerpo anti-GST (panel derecho) para detectar la expresión de péptidos de fusión de GST y luego se sondaron con trastuzumab (panel izquierdo) o IgG en suero humano (panel central). Carril 1, GST; carril 2, GST-H98; carril 3, GST-HER-2; carril 4, DHFR-H98.Ver Figura de Imagen Grande VisorDescargar imagen de alta resolución Descargar (PPT) GST-H98 y péptido H98 Inhibición de la unión de trastuzumab a HER-2-Los resultados del ELISA y la transferencia Western anteriores mostraron que el péptido H98 se unía a las regiones variables de trastuzumab. Sin embargo, para demostrar que H98 se parecía al epítopo de HER-2, tuvimos que demostrar que H98 bloqueaba la unión entre trastuzumab y HER-2. Para realizar estos experimentos, utilizamos un ELISA en el que se preincubaron anticuerpos e inhibidores (GST-H98 o péptido H98) y se colocaron en placas sobre las placas de microtitulación recubiertas con HER-2. Este análisis reveló que GST-H98 y el péptido H98 inhibieron la unión de trastuzumab a HER-2 de una manera dependiente de la dosis, pero la proteína GST y el péptido irrelevante F56 no produjeron una inhibición notable en su interacción (Fig. 3A). HER-2 que inhibe la unión de trastuzumab a GST-H98: para demostrar que el trastuzumab que se une a GST-H98 o al péptido H98 era específico para HER-2, utilizamos HER-2 para inhibir la unión de trastuzumab a GST-H98. El trastuzumab se premezcló con diferentes diluciones de HER-2. Los resultados muestran que HER-2 inhibió significativamente la unión de trastuzumab a GST-H98 (Fig. 3B). En la Fig. 3B, GST solo también demostró una inhibición dependiente de la concentración en la unión de trastuzumab a GST-H98, pero la proteína de fusión GST-H98 duplicó o triplicó el efecto de inhibición, en comparación con GST. Los resultados demostraron que el péptido H98 desempeñó un papel fundamental en la inhibición de la unión de trastuzumab a GST-H98. El péptido H98 bloqueó la función de trastuzumab en la inhibición del crecimiento celular: se sabe que el trastuzumab inhibe el crecimiento de las células de cáncer de mama a través de la interacción con HER-2. Debido a que el péptido H98 tiene la capacidad de bloquear la interacción entre trastuzumab y HER-2, decidimos probar si el péptido H98 afecta la capacidad de trastuzumab para inhibir el crecimiento celular. Como se muestra en la Fig. 4, la respuesta de la célula de cáncer de mama SKBR3 al trastuzumab fue bloqueada significativamente por el péptido H98 de una manera dependiente de la dosis y la tasa de bloqueo del 50% se alcanzó cuando el péptido H98 estaba presente a una concentración de 60 μg/ml, mientras que una concentración equivalente del péptido de control no tuvo un efecto significativo sobre la inhibición del crecimiento celular. Ratones inmunizados con anticuerpos anti-HER-2 fabricados con GST-H98: el péptido H98 se expresó como una proteína de fusión de GST (GST-H98) y las inmunogenicidades se evaluaron en ratones. Cuatro de 5 ratones inmunizados con GST-H98 generaron anticuerpo específico de péptido (Fig. 5A), así como el anticuerpo contra HER-2 (Fig. 5B) después de la quinta inmunización. La respuesta anti-HER-2 fue menor que la respuesta antipéptido, y la respuesta antipéptido H98 pudo detectarse antes que la respuesta anti-HER-2. No se observó respuesta antipéptido o anti-HER-2 en ratones inmunizados con GST. Uno de los 5 ratones generó anticuerpos contra HER-2 que se pudieron detectar en un ensayo de inmunoprecipitación por transferencia Western (datos no mostrados). Desarrollo de la respuesta inmunitaria celular: la inmunidad celular inducida en ratones que se inmunizaron con GST-H98 o GST-otro péptido se evaluó con un ensayo de proliferación de células T. Los bazos de dos ratones se aislaron para su uso en este ensayo. La proliferación de células T se analizó como se describe en "Procedimientos experimentales" utilizando H98 como estimulante. Los resultados que se muestran en la Fig. 6 indican que la proliferación de células T tuvo lugar en ratones inmunizados con GST-H98 pero no en ratones inmunizados con GST-otro péptido. Determinantes estructurales de la unión de H98 a trastuzumab: la disminución de la longitud del péptido puede simplificar las modificaciones de la secuencia peptídica, así como proporcionar una indicación de las características de la hendidura de unión. Los resultados de ELISA y transferencia Western mostraron que entre 15 tipos de GST-H98, incluida la proteína de fusión de péptido truncado de GST y mutante de GST, solo GST-H98, GST-C10, GST-MutN1-2, GST-MutN1 y GST-cíclico H98 fueron capaces de unirse específicamente a trastuzumab (Figs. 7 y 8). Fig. 8Análisis de transferencia Western de la unión de trastuzumab a diferentes proteínas de fusión de péptidos GST. Las proteínas de fusión GST se prepararon como se describe en "Procedimientos experimentales.Se sometieron cantidades iguales (2 μg) de proteínas a SDS-PAGE y se transfirieron a membranas de nitrocelulosa. El anticuerpo anti-GST (panel superior)o trastuzumab (panel inferior) se utilizaron por separado como los primeros anticuerpos, y se aplicó un anticuerpo secundario conjugado con HRP para detectar las reacciones proteicas como se describe en "Procedimientos experimentales." Carril 1, GST; carril 2, GST-H98; carril 3, GST-N10; carril 4, GST-N8; carril 5, GST-N6; carril 6, GST-C10; carril 7, GST-C8; carril 8, GST-C6; carril 9, GST-M8; carril 10, GST-M6; carril 11, GST-MutN3-4; carril 12, GST-MutC1-2; carril 13, GST-MutN1-2; carril 14, GST-MutN1; carril 15, GST-cyclic H98. Visualizador de figuras de imágenes grandes. Descargar imagen Hi-res (PPT) Como se muestra en las Figs. 7 y 8, GST-MutN3-4 (mutante de GP N-terminal a VA) y GST-C8 no podrían unirse a trastuzumab, pero GST-C10 podría unirse a trastuzumab. Estas diferencias en las capacidades de unión implican que los aminoácidos tercero y cuarto, glicina (Gly) y prolina (Pro), en el extremo N fueron esenciales para la actividad del péptido H98. Además, ni GST-MutC1–2 (mutante de SH C-terminal a GA) ni GST-N10 pudieron unirse a trastuzumab, lo que sugirió que la serina (Ser) y la histidina (His) en el extremo C también eran esenciales para retener la actividad de unión completa al péptido. Alternativamente, la capacidad de GST-MutN1-2 para unirse a trastuzumab se vio significativamente afectada, pero no completamente abolida, lo que implicaba que las dos primeras leucinas (LL) en el extremo N no eran muy importantes para la actividad de unión de H98, pero era probable que tuvieran un efecto sobre la formación de la estructura marginal del péptido. La eliminación adicional de 4 o 6 residuos en el extremo N o C eliminó por completo la capacidad del péptido H98 para unirse a trastuzumab. Por lo tanto, parece que el péptido debe tener más de 8 aminoácidos de longitud para cumplir con los requisitos de unión. Accordi

Files

pdf.pdf

Files (16.1 kB)

⚠️ Please wait a few minutes before your translated files are ready ⚠️ Note: Some files might be protected thus translations might not work.
Name Size Download all
md5:e05773879925d8cbbadc279ab28cd863
16.1 kB
Preview Download

Additional details

Additional titles

Translated title (Arabic)
ببتيد جديد معزول من مكتبة ببتيد عرض العاثيات مع تراستوزوماب يمكن أن يحاكي مستضد HER -2
Translated title (French)
Un nouveau peptide isolé à partir d'une bibliothèque de peptides d'exposition de phages avec le trastuzumab peut imiter l'épitope antigénique de HER-2
Translated title (Spanish)
Un nuevo péptido aislado de una biblioteca de péptidos de presentación en fagos con trastuzumab puede imitar el epítopo del antígeno de HER-2

Identifiers

Other
https://openalex.org/W1993589090
DOI
10.1074/jbc.m411047200

Is supplement to
https://openalex.org/W3144787093 (Other)
https://openalex.org/W2601302462 (Other)
https://openalex.org/W2477261495 (Other)
https://openalex.org/W2388088547 (Other)
https://openalex.org/W2381341119 (Other)
https://openalex.org/W2380579232 (Other)
https://openalex.org/W2256226479 (Other)
https://openalex.org/W2175294133 (Other)
https://openalex.org/W2043061837 (Other)
https://openalex.org/W2027698777 (Other)

GreSIS Basics Section

Is Global South Knowledge
Yes
Country
China

References

  • https://openalex.org/W1522722282
  • https://openalex.org/W1559176388
  • https://openalex.org/W1570981769
  • https://openalex.org/W1613185904
  • https://openalex.org/W1820106848
  • https://openalex.org/W1964321121
  • https://openalex.org/W1965414380
  • https://openalex.org/W1980390953
  • https://openalex.org/W2024651005
  • https://openalex.org/W2042476705
  • https://openalex.org/W2087805561
  • https://openalex.org/W2093207006
  • https://openalex.org/W2095156669
  • https://openalex.org/W2097069074
  • https://openalex.org/W2123206362
  • https://openalex.org/W2133605826
  • https://openalex.org/W2141393790
  • https://openalex.org/W2159363679
  • https://openalex.org/W2314225431
  • https://openalex.org/W317612959
  • https://openalex.org/W4242357901